ID: 1109865731

View in Genome Browser
Species Human (GRCh38)
Location 13:68260773-68260795
Sequence CCATCTAGAAAGAGGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109865731_1109865744 30 Left 1109865731 13:68260773-68260795 CCTGCCCCCCTCTTTCTAGATGG No data
Right 1109865744 13:68260826-68260848 TCAAATGCATCCTGAACCCCTGG 0: 19
1: 41
2: 34
3: 74
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109865731 Original CRISPR CCATCTAGAAAGAGGGGGGC AGG (reversed) Intergenic
No off target data available for this crispr