ID: 1109868660

View in Genome Browser
Species Human (GRCh38)
Location 13:68301947-68301969
Sequence TTTTCTTGAAGTGGCCGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109868660_1109868663 5 Left 1109868660 13:68301947-68301969 CCTCCACGGCCACTTCAAGAAAA 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1109868663 13:68301975-68301997 AAGAGCCACTTCGACCTCTTTGG 0: 1
1: 2
2: 16
3: 27
4: 91
1109868660_1109868666 10 Left 1109868660 13:68301947-68301969 CCTCCACGGCCACTTCAAGAAAA 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1109868666 13:68301980-68302002 CCACTTCGACCTCTTTGGCTGGG 0: 1
1: 2
2: 1
3: 8
4: 89
1109868660_1109868664 9 Left 1109868660 13:68301947-68301969 CCTCCACGGCCACTTCAAGAAAA 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1109868664 13:68301979-68302001 GCCACTTCGACCTCTTTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109868660 Original CRISPR TTTTCTTGAAGTGGCCGTGG AGG (reversed) Intergenic
907026630 1:51126414-51126436 TTTTTTTAAAGTGGACATGGTGG - Intronic
909365242 1:74813035-74813057 GTTTCTTGAAGTGGTGGTGGGGG + Intergenic
910789541 1:91036869-91036891 TTTGCTTGAAGTGCCCATAGTGG - Intergenic
911239772 1:95452474-95452496 TTTCCCTGAAGTGGCAGTTGTGG + Intergenic
911239903 1:95453769-95453791 TTTCCCTGAAGTGGCAGTTGTGG + Intergenic
912243502 1:107937082-107937104 TTTTTTTGGGGTGGCGGTGGAGG - Intronic
913127933 1:115810671-115810693 TCTTCTCCAAGTGGCCTTGGTGG - Intergenic
914248118 1:145900870-145900892 TTTTGCTGATGTGGCTGTGGGGG - Exonic
916494159 1:165329617-165329639 TTTTTTTGCAGTGGCGGGGGTGG - Intronic
922983410 1:229847875-229847897 ATTTCTTAGAGTGGCAGTGGTGG + Intergenic
1065787693 10:29231370-29231392 GTTTCTTAAAGTGGGCATGGAGG + Intergenic
1070034426 10:72707959-72707981 TTTTTTTGAACTGAACGTGGTGG - Intronic
1074538251 10:114344423-114344445 TTTTTTTGAAGTGGCAGCAGAGG - Intronic
1074829325 10:117237719-117237741 TGTTTGAGAAGTGGCCGTGGAGG + Intergenic
1076046978 10:127302020-127302042 TTTTCTTGCAGTGGCCCTGTGGG + Intronic
1084194827 11:67518551-67518573 TTTTCCTGCAGTAGCCTTGGAGG - Intergenic
1084307920 11:68298803-68298825 TTTTCTGGAGGTGGCAGAGGAGG - Intergenic
1097283422 12:57860004-57860026 TCTTCTTGAGGTGGAAGTGGTGG + Intergenic
1098612818 12:72482645-72482667 TTTGATTGTAGTGGCAGTGGTGG + Intronic
1103602186 12:122061418-122061440 TTTGCCTGGCGTGGCCGTGGTGG - Exonic
1103690796 12:122773168-122773190 TTTTTTTAAACTGGGCGTGGTGG - Intergenic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1108350535 13:49586703-49586725 TTTTCTTTAAGTGGGGGAGGTGG - Intergenic
1109780326 13:67102334-67102356 TTTTCCAGAAGAGTCCGTGGAGG - Intronic
1109868660 13:68301947-68301969 TTTTCTTGAAGTGGCCGTGGAGG - Intergenic
1110018982 13:70444801-70444823 TTTTCTTGTATTGGCAGAGGAGG - Intergenic
1110663342 13:78085609-78085631 TTTCCTTGCAGTGGCCAAGGCGG + Intergenic
1113366294 13:109679743-109679765 TTTTTTTGAAGGGGCGGGGGAGG + Intergenic
1113915086 13:113865466-113865488 TTGTTTTGAAGTAGCCGTGGTGG - Intergenic
1114206606 14:20577847-20577869 TGTTCTTTAAGTGTCCGGGGAGG - Intergenic
1114307495 14:21437189-21437211 TTTACCTGCAGTGGCTGTGGGGG + Intronic
1114642225 14:24231477-24231499 TTTTTTTGAGGGGGGCGTGGGGG + Intronic
1116732760 14:48645262-48645284 CTTTGTGGAAGTGGTCGTGGTGG + Intergenic
1121982420 14:98466463-98466485 TGTTCTTGAGATGGCCATGGAGG + Intergenic
1122059429 14:99126662-99126684 TTTTCTTGATGTTGCCATGAAGG - Intergenic
1122277893 14:100604553-100604575 CTTCCTTGAAGTGGGGGTGGCGG + Intergenic
1124375268 15:29125563-29125585 TTTTCATGAAGTGGAAGTGCAGG - Intronic
1124472254 15:29998459-29998481 CTTTCTTTCAGTGGCCTTGGAGG - Intergenic
1125435272 15:39637524-39637546 GTTTACTGAAGTGGCAGTGGTGG - Intronic
1126281795 15:46961272-46961294 GTCTCTTGCAGTGGCCATGGTGG - Intergenic
1128993030 15:72276302-72276324 TCTCCTTCAAGTGGCCATGGAGG - Intronic
1129018641 15:72493080-72493102 TCTTCTGGAAGTGGCTGTGAAGG - Intronic
1129989371 15:79948865-79948887 TTTCCTTGGAGTGGGGGTGGGGG - Intergenic
1130879021 15:88039050-88039072 TTTTCTTGAAGCTGCTGAGGTGG + Intronic
1130924176 15:88372841-88372863 TTTGTTTGAATTGACCGTGGAGG - Intergenic
1131261652 15:90890922-90890944 CCTTGTTGAAGAGGCCGTGGGGG - Intronic
1133292769 16:4734013-4734035 TTTTCTTTATGTGGTTGTGGTGG - Exonic
1134130214 16:11644186-11644208 TTTTCTTGAAGAGGAGCTGGTGG - Intergenic
1135403378 16:22181512-22181534 TCTTCTTGATGTGGCCCTGGTGG - Exonic
1135796316 16:25446232-25446254 GTTTCTTGAAGAGGCGGCGGGGG - Intergenic
1140168239 16:72576816-72576838 TTTTCTTAAAGTTGCCATGCGGG + Intergenic
1140780139 16:78288426-78288448 TTTTGTTGTGGTGGCAGTGGTGG + Intronic
1141599100 16:85114446-85114468 TTTACGTGAGGTGGACGTGGGGG - Intergenic
1142884456 17:2903996-2904018 TTCTCTGGAGGTGGCAGTGGGGG + Intronic
1144205370 17:12976111-12976133 TTTTCTGGCAGTGGTCATGGAGG - Intronic
1148815796 17:50327119-50327141 TTTTCTTTCAGTGGAAGTGGAGG - Intergenic
1150638808 17:66935436-66935458 TTTTCTTGGAGTGTCCATTGGGG + Intergenic
1155036300 18:22027496-22027518 GTTTCTTGCTGTGGCCTTGGTGG - Intergenic
1155227178 18:23738757-23738779 CTTTCTGGAAGTGGCTGTGATGG - Intronic
1155407390 18:25503772-25503794 TATCCTTGAAAGGGCCGTGGAGG - Intergenic
1156707391 18:39899756-39899778 TTTTTTTGGAGTGGGGGTGGTGG - Intergenic
1160512388 18:79459818-79459840 TTTTTATGAAGTGGGGGTGGAGG + Intronic
1161369511 19:3902674-3902696 TATGGTGGAAGTGGCCGTGGTGG + Intronic
1163748225 19:19060464-19060486 TATGCCTGAAGTGGCCGAGGGGG - Intergenic
1164798696 19:31057981-31058003 TTTTCTTGGAATGCCCTTGGAGG + Intergenic
1165005596 19:32803860-32803882 TTTTTGTGAAGTGCCCGTTGAGG + Intronic
1166116903 19:40661953-40661975 TGTTCTTGAATTGGCTGTGATGG + Intergenic
1166977426 19:46612889-46612911 GTTTATTGAAGTGGCAGAGGTGG - Intergenic
1168684265 19:58338447-58338469 TTTTCTTGAAGTGGATCTGTTGG - Exonic
925531343 2:4866085-4866107 TTTTATAAAAGTGCCCGTGGAGG + Intergenic
931119869 2:59204256-59204278 GTGGCTTGAAGTGGCCTTGGAGG + Intergenic
932578146 2:72973946-72973968 CTTTCTGGGAGTGGCGGTGGTGG - Intronic
936096253 2:109532441-109532463 TCTTCTTGAAATGGCAGTGGGGG + Intergenic
937330754 2:121026793-121026815 TTTTATTGTGGTGGCGGTGGTGG + Intergenic
948904537 2:240972337-240972359 TGTTCCTGAAGTGGGCGGGGTGG + Intronic
1169024802 20:2360704-2360726 TTTTCTTGGTGTGACCATGGGGG + Intergenic
1176072850 20:63235894-63235916 CTTTCTGGAAGTGGCCAGGGTGG - Exonic
951648398 3:24920141-24920163 TTTTCTTGAAGAGGTCCTGCTGG + Intergenic
953267307 3:41403977-41403999 ATTTCTTGAAGTTGCTTTGGTGG + Intronic
955635613 3:61026158-61026180 TCTTCTTGAAGTGGGCGTAGTGG - Intronic
956848467 3:73205806-73205828 TTTTCTGGTAGTGGTGGTGGTGG - Intergenic
957743871 3:84312541-84312563 TTTTATTTAAGTGTCCTTGGTGG + Intergenic
964345945 3:155754910-155754932 TATTTTTGAAGAGGCCATGGAGG + Intergenic
965128087 3:164656147-164656169 TTTTCGTGAGATGTCCGTGGTGG + Intergenic
969085386 4:4652463-4652485 TTTTCCTGGAGGGGCCTTGGTGG - Intergenic
970292613 4:14591411-14591433 TTTTCTTGGAGTGGCATTGCTGG - Intergenic
971471715 4:27033814-27033836 TTTTCTCTAAGTGGCTGTGTTGG - Intergenic
973833834 4:54789485-54789507 TTTTCTTTAACTGGCCCTGAGGG - Intergenic
973857226 4:55024894-55024916 TTTTTTTGAGGTGGGGGTGGGGG + Intergenic
978109540 4:104946029-104946051 TTTTATTGATGAGGCTGTGGAGG + Intergenic
980641836 4:135590249-135590271 TTGTCTTGAAGTGGTCATAGGGG - Intergenic
984063201 4:175017529-175017551 TTTTCTTGAACTGGCAATAGTGG + Intergenic
985489183 5:169283-169305 TTTTAATAAAGTGTCCGTGGGGG + Intronic
985672900 5:1215194-1215216 TTTTCGTGGAGTGGCTGAGGTGG + Intronic
986680250 5:10225782-10225804 TTTTCTAGAAGTGTTCCTGGTGG - Intergenic
989982354 5:50659526-50659548 TTTTTTTAAACTGGGCGTGGTGG + Intergenic
990153256 5:52844785-52844807 TTTTCTGGGAGTGGAAGTGGAGG + Intronic
990946230 5:61252661-61252683 CTTTCCTGAAGCCGCCGTGGTGG + Intergenic
991938740 5:71829572-71829594 TTTGCTGGAAGTGGGCCTGGTGG - Intergenic
997098950 5:130946357-130946379 TTTTATTGAGGTGGTGGTGGTGG + Intergenic
997592542 5:135084750-135084772 TTTTCTTGAAGTGGGATTGCTGG + Intronic
1001118167 5:168956927-168956949 TTTTTTTAAAGTGGATGTGGAGG - Intronic
1002588828 5:180273394-180273416 TTTTCTTAAAGTGGAGATGGGGG + Intronic
1004308471 6:14522499-14522521 TTTTCTTGAAGTTTCCTTTGGGG + Intergenic
1007512619 6:42385716-42385738 TTATGATGAAGTGGCAGTGGTGG - Intronic
1008154378 6:47995787-47995809 TTTTATTGAAGTGTTCCTGGAGG - Intronic
1008760668 6:54848094-54848116 TTTTATTGGAGTGGGGGTGGGGG + Intronic
1009881295 6:69569569-69569591 TCTTCTTGAAGTTTCCGTAGAGG + Intergenic
1012702278 6:102474818-102474840 TTTTATTCAGGTGGCAGTGGAGG + Intergenic
1013349149 6:109290399-109290421 TCTTCTTCCAGTGGCCGAGGTGG - Intergenic
1013487947 6:110616239-110616261 TTATCTTGAGGTGGCACTGGGGG + Intronic
1014165193 6:118216450-118216472 TTTTTTTGAAGTGGGGGTAGGGG - Intronic
1015009892 6:128332845-128332867 GTTTCTTGGAGTGGGCGTTGAGG - Intronic
1015401117 6:132789140-132789162 TTTTCTGGAAGTAGCAATGGGGG + Intronic
1016237667 6:141887652-141887674 TTTGTTTGAAGTGGTGGTGGTGG - Intergenic
1024396344 7:48872782-48872804 TTTTCTTGAATTGTTCGTAGAGG - Intergenic
1026110177 7:67453349-67453371 TTTTTTTGAAGAGACAGTGGGGG + Intergenic
1028644899 7:93084937-93084959 TTTTCTTGAAGTTGCTCTTGGGG - Intergenic
1030801112 7:113853707-113853729 TTTTCTTCCAATGGCCGTAGTGG + Intergenic
1031017332 7:116588876-116588898 TTTTCTTGAATTGTCAGAGGGGG - Intergenic
1032818262 7:135499433-135499455 TTTTCTGTGAGTGGCCTTGGGGG - Intronic
1033370451 7:140702855-140702877 TTGTCTTGCAGTGCCGGTGGTGG + Exonic
1033638547 7:143237691-143237713 TTTTCTGGCAGTGGTAGTGGTGG + Intergenic
1034004508 7:147454823-147454845 TTTTCTTAAAGTTGCAGTGCTGG - Intronic
1036562274 8:9907007-9907029 TTTTGTTGTGGTGGCCGTGGCGG + Intergenic
1037302774 8:17470107-17470129 GCTTCTTGAACTGGCAGTGGTGG + Intergenic
1038538328 8:28370549-28370571 TTTTCTTGAAATGGATGGGGTGG + Intronic
1039578806 8:38647041-38647063 TTTTTTTGGAGTGGGGGTGGTGG - Intergenic
1042890003 8:73598512-73598534 TTTTCTTCTACTGGGCGTGGTGG - Intronic
1049940406 9:540497-540519 TTTTCTTGTAGTGTCCTTGCTGG + Intronic
1052226769 9:26098825-26098847 TTTTCTTGAATGGGCCCTGATGG - Intergenic
1057582158 9:96296565-96296587 TTTTCTTGAGGTGGTCTTGCTGG - Intronic
1058055266 9:100442517-100442539 TCTTATAGAAGTGGGCGTGGTGG + Intronic
1058808278 9:108614324-108614346 TTTTCTTGAATTGGGCATGATGG - Intergenic
1060994923 9:127870516-127870538 TTTTCTAGATGTGGCCCTGAGGG + Intronic
1186095449 X:6096572-6096594 TCTTCTTCAAGTGGCCTTTGAGG - Intronic
1189169876 X:38898606-38898628 TTTGTTTGGAGTGGCTGTGGTGG - Intergenic
1198436220 X:136619204-136619226 TTTTCTGGAAGTAGTTGTGGAGG + Intergenic