ID: 1109869916

View in Genome Browser
Species Human (GRCh38)
Location 13:68321233-68321255
Sequence TGCTGCTTGGGCTTATATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109869916_1109869921 -3 Left 1109869916 13:68321233-68321255 CCTTCATATAAGCCCAAGCAGCA No data
Right 1109869921 13:68321253-68321275 GCATGGACTCACTTTCAGCAGGG No data
1109869916_1109869920 -4 Left 1109869916 13:68321233-68321255 CCTTCATATAAGCCCAAGCAGCA No data
Right 1109869920 13:68321252-68321274 AGCATGGACTCACTTTCAGCAGG No data
1109869916_1109869922 -2 Left 1109869916 13:68321233-68321255 CCTTCATATAAGCCCAAGCAGCA No data
Right 1109869922 13:68321254-68321276 CATGGACTCACTTTCAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109869916 Original CRISPR TGCTGCTTGGGCTTATATGA AGG (reversed) Intergenic
No off target data available for this crispr