ID: 1109869921

View in Genome Browser
Species Human (GRCh38)
Location 13:68321253-68321275
Sequence GCATGGACTCACTTTCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109869916_1109869921 -3 Left 1109869916 13:68321233-68321255 CCTTCATATAAGCCCAAGCAGCA No data
Right 1109869921 13:68321253-68321275 GCATGGACTCACTTTCAGCAGGG No data
1109869914_1109869921 3 Left 1109869914 13:68321227-68321249 CCACACCCTTCATATAAGCCCAA No data
Right 1109869921 13:68321253-68321275 GCATGGACTCACTTTCAGCAGGG No data
1109869915_1109869921 -2 Left 1109869915 13:68321232-68321254 CCCTTCATATAAGCCCAAGCAGC No data
Right 1109869921 13:68321253-68321275 GCATGGACTCACTTTCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109869921 Original CRISPR GCATGGACTCACTTTCAGCA GGG Intergenic
No off target data available for this crispr