ID: 1109876041

View in Genome Browser
Species Human (GRCh38)
Location 13:68405574-68405596
Sequence GGCTGTACCCTGCAAAATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109876041_1109876048 20 Left 1109876041 13:68405574-68405596 CCTACATTTTGCAGGGTACAGCC No data
Right 1109876048 13:68405617-68405639 GAGCTGGCATTCAATGTCTGTGG No data
1109876041_1109876045 4 Left 1109876041 13:68405574-68405596 CCTACATTTTGCAGGGTACAGCC No data
Right 1109876045 13:68405601-68405623 TCCTAGCTGTTTCCATGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109876041 Original CRISPR GGCTGTACCCTGCAAAATGT AGG (reversed) Intergenic
No off target data available for this crispr