ID: 1109882167

View in Genome Browser
Species Human (GRCh38)
Location 13:68494048-68494070
Sequence GCTTTTTTGGGACCATGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109882163_1109882167 -3 Left 1109882163 13:68494028-68494050 CCTTGGCTTTTTGCCTAGAGGCT No data
Right 1109882167 13:68494048-68494070 GCTTTTTTGGGACCATGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109882167 Original CRISPR GCTTTTTTGGGACCATGATG AGG Intergenic
No off target data available for this crispr