ID: 1109884356

View in Genome Browser
Species Human (GRCh38)
Location 13:68523987-68524009
Sequence CGTCCACCTGGAACTCACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109884356_1109884364 15 Left 1109884356 13:68523987-68524009 CCAGCGTGAGTTCCAGGTGGACG No data
Right 1109884364 13:68524025-68524047 CTGCACTCGGAACAGCCAGCTGG No data
1109884356_1109884361 2 Left 1109884356 13:68523987-68524009 CCAGCGTGAGTTCCAGGTGGACG No data
Right 1109884361 13:68524012-68524034 GGATCAGTGGGCCCTGCACTCGG No data
1109884356_1109884365 24 Left 1109884356 13:68523987-68524009 CCAGCGTGAGTTCCAGGTGGACG No data
Right 1109884365 13:68524034-68524056 GAACAGCCAGCTGGCGCTGCCGG No data
1109884356_1109884360 -10 Left 1109884356 13:68523987-68524009 CCAGCGTGAGTTCCAGGTGGACG No data
Right 1109884360 13:68524000-68524022 CAGGTGGACGCAGGATCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109884356 Original CRISPR CGTCCACCTGGAACTCACGC TGG (reversed) Intergenic
No off target data available for this crispr