ID: 1109891855

View in Genome Browser
Species Human (GRCh38)
Location 13:68624794-68624816
Sequence AGCTCTTAGTTAATGCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109891852_1109891855 -4 Left 1109891852 13:68624775-68624797 CCAACAGGAATAAGTAAGCAGCT No data
Right 1109891855 13:68624794-68624816 AGCTCTTAGTTAATGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109891855 Original CRISPR AGCTCTTAGTTAATGCTGGT GGG Intergenic
No off target data available for this crispr