ID: 1109895891

View in Genome Browser
Species Human (GRCh38)
Location 13:68689486-68689508
Sequence TTCATCCCACTTCAGATCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109895890_1109895891 15 Left 1109895890 13:68689448-68689470 CCTTCACATTGTATAGCACTTAC No data
Right 1109895891 13:68689486-68689508 TTCATCCCACTTCAGATCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109895891 Original CRISPR TTCATCCCACTTCAGATCTA AGG Intergenic
No off target data available for this crispr