ID: 1109899876

View in Genome Browser
Species Human (GRCh38)
Location 13:68753570-68753592
Sequence CTGGGTATATACTCAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109899866_1109899876 26 Left 1109899866 13:68753521-68753543 CCTCAAGGGTCTAGAACCAGAAA 0: 53
1: 3093
2: 7659
3: 16219
4: 5635
Right 1109899876 13:68753570-68753592 CTGGGTATATACTCAGAGGATGG No data
1109899872_1109899876 -8 Left 1109899872 13:68753555-68753577 CCAGCAATCCCATTGCTGGGTAT 0: 171
1: 6916
2: 24960
3: 15341
4: 10741
Right 1109899876 13:68753570-68753592 CTGGGTATATACTCAGAGGATGG No data
1109899868_1109899876 1 Left 1109899868 13:68753546-68753568 CCATTTGACCCAGCAATCCCATT 0: 5878
1: 21311
2: 11121
3: 8845
4: 9411
Right 1109899876 13:68753570-68753592 CTGGGTATATACTCAGAGGATGG No data
1109899867_1109899876 10 Left 1109899867 13:68753537-68753559 CCAGAAATACCATTTGACCCAGC 0: 3237
1: 2913
2: 1384
3: 508
4: 369
Right 1109899876 13:68753570-68753592 CTGGGTATATACTCAGAGGATGG No data
1109899871_1109899876 -7 Left 1109899871 13:68753554-68753576 CCCAGCAATCCCATTGCTGGGTA 0: 139
1: 6265
2: 21844
3: 10600
4: 6654
Right 1109899876 13:68753570-68753592 CTGGGTATATACTCAGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109899876 Original CRISPR CTGGGTATATACTCAGAGGA TGG Intergenic
No off target data available for this crispr