ID: 1109901705

View in Genome Browser
Species Human (GRCh38)
Location 13:68781175-68781197
Sequence ATGTATTTGCGGAAGCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109901705_1109901708 12 Left 1109901705 13:68781175-68781197 CCACTCTGCTTCCGCAAATACAT No data
Right 1109901708 13:68781210-68781232 ATCAACATCTGTCATCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109901705 Original CRISPR ATGTATTTGCGGAAGCAGAG TGG (reversed) Intergenic
No off target data available for this crispr