ID: 1109905911

View in Genome Browser
Species Human (GRCh38)
Location 13:68841636-68841658
Sequence AAATGTTCGTAGAAGTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109905911_1109905915 19 Left 1109905911 13:68841636-68841658 CCTTGAGACTTCTACGAACATTT No data
Right 1109905915 13:68841678-68841700 CCTAGAAAATCCAGAGGAAATGG No data
1109905911_1109905913 13 Left 1109905911 13:68841636-68841658 CCTTGAGACTTCTACGAACATTT No data
Right 1109905913 13:68841672-68841694 TTGCGACCTAGAAAATCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109905911 Original CRISPR AAATGTTCGTAGAAGTCTCA AGG (reversed) Intergenic
No off target data available for this crispr