ID: 1109907600

View in Genome Browser
Species Human (GRCh38)
Location 13:68865449-68865471
Sequence TCTCAAATACTGAGGTCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109907600_1109907605 -6 Left 1109907600 13:68865449-68865471 CCAACTGACCTCAGTATTTGAGA No data
Right 1109907605 13:68865466-68865488 TTGAGAACAGCCTTGGGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109907600 Original CRISPR TCTCAAATACTGAGGTCAGT TGG (reversed) Intergenic
No off target data available for this crispr