ID: 1109907605

View in Genome Browser
Species Human (GRCh38)
Location 13:68865466-68865488
Sequence TTGAGAACAGCCTTGGGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109907599_1109907605 1 Left 1109907599 13:68865442-68865464 CCTGTGGCCAACTGACCTCAGTA No data
Right 1109907605 13:68865466-68865488 TTGAGAACAGCCTTGGGGATAGG No data
1109907598_1109907605 2 Left 1109907598 13:68865441-68865463 CCCTGTGGCCAACTGACCTCAGT No data
Right 1109907605 13:68865466-68865488 TTGAGAACAGCCTTGGGGATAGG No data
1109907600_1109907605 -6 Left 1109907600 13:68865449-68865471 CCAACTGACCTCAGTATTTGAGA No data
Right 1109907605 13:68865466-68865488 TTGAGAACAGCCTTGGGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109907605 Original CRISPR TTGAGAACAGCCTTGGGGAT AGG Intergenic
No off target data available for this crispr