ID: 1109908956

View in Genome Browser
Species Human (GRCh38)
Location 13:68885360-68885382
Sequence CAGTCACAGCAGTGTGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109908953_1109908956 3 Left 1109908953 13:68885334-68885356 CCCTGCATGGACTGAAGACCATT No data
Right 1109908956 13:68885360-68885382 CAGTCACAGCAGTGTGACACTGG No data
1109908945_1109908956 15 Left 1109908945 13:68885322-68885344 CCCCACCCCACCCCCTGCATGGA 0: 1
1: 0
2: 13
3: 112
4: 840
Right 1109908956 13:68885360-68885382 CAGTCACAGCAGTGTGACACTGG No data
1109908949_1109908956 9 Left 1109908949 13:68885328-68885350 CCCACCCCCTGCATGGACTGAAG No data
Right 1109908956 13:68885360-68885382 CAGTCACAGCAGTGTGACACTGG No data
1109908941_1109908956 24 Left 1109908941 13:68885313-68885335 CCGCGCTCCCCCCACCCCACCCC 0: 1
1: 82
2: 1584
3: 10206
4: 13577
Right 1109908956 13:68885360-68885382 CAGTCACAGCAGTGTGACACTGG No data
1109908952_1109908956 4 Left 1109908952 13:68885333-68885355 CCCCTGCATGGACTGAAGACCAT No data
Right 1109908956 13:68885360-68885382 CAGTCACAGCAGTGTGACACTGG No data
1109908948_1109908956 10 Left 1109908948 13:68885327-68885349 CCCCACCCCCTGCATGGACTGAA No data
Right 1109908956 13:68885360-68885382 CAGTCACAGCAGTGTGACACTGG No data
1109908942_1109908956 17 Left 1109908942 13:68885320-68885342 CCCCCCACCCCACCCCCTGCATG 0: 1
1: 2
2: 25
3: 227
4: 1642
Right 1109908956 13:68885360-68885382 CAGTCACAGCAGTGTGACACTGG No data
1109908951_1109908956 5 Left 1109908951 13:68885332-68885354 CCCCCTGCATGGACTGAAGACCA No data
Right 1109908956 13:68885360-68885382 CAGTCACAGCAGTGTGACACTGG No data
1109908940_1109908956 27 Left 1109908940 13:68885310-68885332 CCACCGCGCTCCCCCCACCCCAC No data
Right 1109908956 13:68885360-68885382 CAGTCACAGCAGTGTGACACTGG No data
1109908950_1109908956 8 Left 1109908950 13:68885329-68885351 CCACCCCCTGCATGGACTGAAGA No data
Right 1109908956 13:68885360-68885382 CAGTCACAGCAGTGTGACACTGG No data
1109908947_1109908956 13 Left 1109908947 13:68885324-68885346 CCACCCCACCCCCTGCATGGACT No data
Right 1109908956 13:68885360-68885382 CAGTCACAGCAGTGTGACACTGG No data
1109908943_1109908956 16 Left 1109908943 13:68885321-68885343 CCCCCACCCCACCCCCTGCATGG 0: 1
1: 0
2: 19
3: 160
4: 1261
Right 1109908956 13:68885360-68885382 CAGTCACAGCAGTGTGACACTGG No data
1109908954_1109908956 2 Left 1109908954 13:68885335-68885357 CCTGCATGGACTGAAGACCATTG No data
Right 1109908956 13:68885360-68885382 CAGTCACAGCAGTGTGACACTGG No data
1109908946_1109908956 14 Left 1109908946 13:68885323-68885345 CCCACCCCACCCCCTGCATGGAC No data
Right 1109908956 13:68885360-68885382 CAGTCACAGCAGTGTGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109908956 Original CRISPR CAGTCACAGCAGTGTGACAC TGG Intergenic
No off target data available for this crispr