ID: 1109913522

View in Genome Browser
Species Human (GRCh38)
Location 13:68948816-68948838
Sequence GTGTGTATGTTTAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109913517_1109913522 -5 Left 1109913517 13:68948798-68948820 CCTATGCAATATTTCTCTGTGTG No data
Right 1109913522 13:68948816-68948838 GTGTGTATGTTTAGGGAGGAGGG No data
1109913515_1109913522 13 Left 1109913515 13:68948780-68948802 CCTTCCATTTTTAGAAAACCTAT No data
Right 1109913522 13:68948816-68948838 GTGTGTATGTTTAGGGAGGAGGG No data
1109913516_1109913522 9 Left 1109913516 13:68948784-68948806 CCATTTTTAGAAAACCTATGCAA No data
Right 1109913522 13:68948816-68948838 GTGTGTATGTTTAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109913522 Original CRISPR GTGTGTATGTTTAGGGAGGA GGG Intergenic
No off target data available for this crispr