ID: 1109916203

View in Genome Browser
Species Human (GRCh38)
Location 13:68987947-68987969
Sequence TGTATTGTTTAGCATATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109916203_1109916207 21 Left 1109916203 13:68987947-68987969 CCTTCTATATGCTAAACAATACA No data
Right 1109916207 13:68987991-68988013 CTAGTACAGCAAAAATTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109916203 Original CRISPR TGTATTGTTTAGCATATAGA AGG (reversed) Intergenic
No off target data available for this crispr