ID: 1109918508

View in Genome Browser
Species Human (GRCh38)
Location 13:69023817-69023839
Sequence AAGAAGTAGTAGAAACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109918508_1109918512 -1 Left 1109918508 13:69023817-69023839 CCTTCCTGTTTCTACTACTTCTT No data
Right 1109918512 13:69023839-69023861 TGACAGGTGGAGCTCTCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109918508 Original CRISPR AAGAAGTAGTAGAAACAGGA AGG (reversed) Intergenic
No off target data available for this crispr