ID: 1109922962

View in Genome Browser
Species Human (GRCh38)
Location 13:69093156-69093178
Sequence TATACCAAGGTGCCTAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109922962_1109922966 24 Left 1109922962 13:69093156-69093178 CCATCTCTAGGCACCTTGGTATA No data
Right 1109922966 13:69093203-69093225 CTTTTCAGCCACTTTCACCTTGG No data
1109922962_1109922964 0 Left 1109922962 13:69093156-69093178 CCATCTCTAGGCACCTTGGTATA No data
Right 1109922964 13:69093179-69093201 GTAAGTCTTCTGAAAACTGCTGG No data
1109922962_1109922965 1 Left 1109922962 13:69093156-69093178 CCATCTCTAGGCACCTTGGTATA No data
Right 1109922965 13:69093180-69093202 TAAGTCTTCTGAAAACTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109922962 Original CRISPR TATACCAAGGTGCCTAGAGA TGG (reversed) Intergenic
No off target data available for this crispr