ID: 1109927031

View in Genome Browser
Species Human (GRCh38)
Location 13:69157332-69157354
Sequence GTGAATAATGCTATGAATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 2, 1: 6, 2: 25, 3: 59, 4: 298}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109927031 Original CRISPR GTGAATAATGCTATGAATAT TGG (reversed) Intergenic
901117793 1:6862458-6862480 TTGAATAATGCCATGAACATAGG + Intronic
901690295 1:10968792-10968814 GTGACTAATTCTCTGATTATTGG + Intronic
902940096 1:19794697-19794719 GTGAATAATTCTGTAAACATGGG - Intronic
903520556 1:23944619-23944641 GTGAATAATGCTTTGAACATGGG + Intergenic
903898706 1:26626429-26626451 GTGAATAATAATATAAATGTAGG + Intergenic
904204417 1:28843939-28843961 AAGAATACTGCTATGAACATGGG + Intronic
905701110 1:40015237-40015259 GGGAATCATGCTATGTATATTGG + Intergenic
910392620 1:86760481-86760503 AATAATACTGCTATGAATATAGG + Intergenic
910946790 1:92601408-92601430 GTGAATAATGCAGTGAACACGGG - Intronic
911289071 1:96033717-96033739 GTGATTAATGCTATAAAGAATGG - Intergenic
911518582 1:98900002-98900024 GAGAATATAGCTATGAATAAGGG - Intronic
912314979 1:108660172-108660194 GTGAATAATGCTATGAACTTCGG - Intronic
912881252 1:113417701-113417723 GTGATAAATGCTATGAATGAGGG - Intronic
913669952 1:121087974-121087996 GAAAATCATGCTCTGAATATGGG - Intronic
914021718 1:143875372-143875394 GAAAATCATGCTCTGAATATGGG - Intergenic
914660204 1:149783323-149783345 GAAAATCATGCTCTGAATATGGG - Intronic
915738362 1:158098961-158098983 CTGAACATTGCTATGAACATAGG - Intronic
916202165 1:162282494-162282516 GTAAATACTGCTGTGAACATGGG + Intronic
916933960 1:169608654-169608676 ATTAATAGTGCTATGAACATGGG + Intronic
917886261 1:179388287-179388309 GTGAATTATGGTATAGATATAGG - Intronic
917917376 1:179716104-179716126 GTGAATAATGCTGCAAATATGGG + Intergenic
917993078 1:180403626-180403648 GTGAATTATGCTCTGAACATAGG - Intronic
918919397 1:190688689-190688711 GTCAATAATTCTCAGAATATGGG - Intergenic
918919965 1:190697016-190697038 GTTAATAATGATATTGATATTGG + Intergenic
919365020 1:196649391-196649413 TTGAATAATGCTATAACAATTGG + Intergenic
920518825 1:206607639-206607661 GAGGATAATGATATGCATATAGG + Intronic
921854119 1:219963039-219963061 GTGAATGATGCTATGAACATGGG - Intergenic
923785179 1:237059756-237059778 ATGAAGAATGCCATAAATATTGG + Intronic
923903134 1:238351452-238351474 GTCAATAATGTCATTAATATAGG + Intergenic
924128426 1:240880426-240880448 GAGACTAATGCTATTAATCTTGG + Intronic
924547052 1:245039090-245039112 GTGAATAATGCAGTAAATAAGGG - Intronic
1062763072 10:42028-42050 GTGAATGCTGCTATAAACATGGG - Intergenic
1063555973 10:7080170-7080192 GTGAATGCTGCTATGAACATGGG + Intergenic
1064853126 10:19733202-19733224 ATGAATATTGCCATGAATATTGG - Intronic
1065281563 10:24144169-24144191 TTGAAAAATGCTTTGAAGATTGG - Intronic
1067495237 10:46755603-46755625 GTGAATAGAAATATGAATATAGG - Intergenic
1067599417 10:47584785-47584807 GTGAATAGAAATATGAATATAGG + Intergenic
1067949076 10:50711371-50711393 GTGAATAGAAATATGAATATAGG + Intergenic
1068847191 10:61691176-61691198 GTGAATATTGATATGCTTATTGG - Intronic
1069651112 10:70050043-70050065 GTGCATAATATTATGAATACAGG - Intergenic
1070075204 10:73128181-73128203 GTGAATACTGCAGTGAACATGGG + Intronic
1070706557 10:78643317-78643339 GTGAACAGTGCCATGAATATGGG + Intergenic
1070716180 10:78723378-78723400 GTCAATAATCATATGAAAATAGG + Intergenic
1070884390 10:79876377-79876399 GTGAATAGAAATATGAATATAGG + Intergenic
1071326612 10:84524916-84524938 GTGATTCATGCTATGATTTTTGG - Intergenic
1071650950 10:87392674-87392696 GTGAATAGAAATATGAATATAGG + Intergenic
1071841064 10:89471887-89471909 GTTAATAATTATATGAAAATTGG - Intronic
1073014858 10:100390339-100390361 GTGAAAAAGGCTATGAGTCTTGG - Intergenic
1073699825 10:105914311-105914333 GTGAATAATGTGATGAACAAGGG - Intergenic
1074257076 10:111813529-111813551 GTGTATACTGCTCAGAATATAGG - Intergenic
1075539814 10:123302701-123302723 GTCAATATTGCTGGGAATATTGG + Intergenic
1077751927 11:4980647-4980669 ATGTATAATTCTATGACTATGGG - Intronic
1077863517 11:6204019-6204041 TTAGATAAAGCTATGAATATGGG - Intergenic
1078189608 11:9081773-9081795 GTGAATAATGCTACGAGCATGGG + Intronic
1078831811 11:14984607-14984629 AAGAATGCTGCTATGAATATGGG + Intronic
1078882929 11:15470906-15470928 GTGAATAACGCTATGGACATGGG + Intergenic
1079189343 11:18264913-18264935 TTTCAGAATGCTATGAATATAGG - Intergenic
1079616617 11:22501916-22501938 GTAAATACTGCTCTGAATGTAGG - Intergenic
1080087741 11:28305694-28305716 GTGATAAATGCTATAAATAATGG + Intronic
1080512639 11:32990030-32990052 GTGAATAATGTAATTAATATGGG - Intronic
1083320023 11:61840045-61840067 GTGAATAGAGCTATGAACACAGG + Intronic
1084886762 11:72215395-72215417 AAGAATACTGCTATGAAAATGGG - Intergenic
1086003529 11:82008701-82008723 ATGAATATTGCTAAGAATAAAGG - Intergenic
1086996505 11:93362955-93362977 GTAAATAATGCTATGAACAATGG - Intronic
1087163168 11:94971150-94971172 GTGGATAATGCTTTTAATGTGGG - Intronic
1087542576 11:99539519-99539541 ATGAAAAATGCTAGAAATATAGG - Intronic
1087629516 11:100634233-100634255 GTGAATAATGCTATGAACACTGG + Intergenic
1087744109 11:101923208-101923230 ATGAATAATGGTATAAAAATTGG + Intronic
1088275095 11:108076654-108076676 GTTAATAATGCAGTGAATGTGGG + Intronic
1088463972 11:110113307-110113329 GTGAATACTGCTATTAACATTGG - Intronic
1090256999 11:125291611-125291633 AGTAATGATGCTATGAATATGGG - Intronic
1090935777 11:131340759-131340781 GTAAAATATTCTATGAATATAGG - Intergenic
1091595628 12:1877144-1877166 GTGAAGAATGCTATAAACAGAGG - Intronic
1092903871 12:13084770-13084792 ACGAATAAGGCTATGAATAAGGG - Intronic
1093163528 12:15778317-15778339 GTGAATAATGCTACAAGTATTGG + Intronic
1094450583 12:30579302-30579324 AATAATACTGCTATGAATATTGG - Intergenic
1094812969 12:34159710-34159732 GTGAATGCTGCTATAAACATGGG - Intergenic
1095126765 12:38488361-38488383 GTGAATACTGGTCTGAACATTGG + Intergenic
1095372914 12:41491193-41491215 GTGAACAATTCTGTGAAAATTGG + Intronic
1095402537 12:41831635-41831657 GTGAATAATGCTATAAACATTGG + Intergenic
1097353817 12:58578570-58578592 GTGAATAGTGCTCAGAACATAGG + Intronic
1097357415 12:58617334-58617356 GTAAAGAAAGCTATGAAAATTGG + Intronic
1098538548 12:71624023-71624045 TTAAATAATGCTATGGATAACGG + Intronic
1098556937 12:71829700-71829722 GGGAATAGTGCTATGAACATAGG + Intergenic
1100111645 12:91251219-91251241 AATAATATTGCTATGAATATAGG + Intergenic
1100493501 12:95103312-95103334 GTGGAGCATGCTATGACTATTGG + Intronic
1101700177 12:107166523-107166545 ATGAATAATACATTGAATATGGG - Intergenic
1101770647 12:107747339-107747361 GTGACCTATGCTATGAACATAGG + Intronic
1101784221 12:107868472-107868494 GTGAATAATGTATTGAACATGGG + Intergenic
1101863544 12:108502333-108502355 GTGAATACTAATATTAATATTGG - Intergenic
1102750878 12:115292898-115292920 ATGAATAATACAATGAACATAGG + Intergenic
1103258824 12:119566595-119566617 GTGAATAATGCTATGAAAATAGG - Intergenic
1103430561 12:120881604-120881626 ATGAGTAATACAATGAATATTGG - Intronic
1104418671 12:128616932-128616954 GTGAATCATGCTATGAGAAATGG + Intronic
1105612529 13:21981615-21981637 GTGAAAGATGCAATGATTATAGG - Intergenic
1106012536 13:25838438-25838460 GTAAATAATGCAGTGAAAATGGG - Intronic
1106848490 13:33763217-33763239 GTGAATAATTTTAAGAAAATTGG - Intergenic
1107106922 13:36653669-36653691 GTTAATGCTGCTATGAACATGGG - Intergenic
1107852375 13:44583542-44583564 GTGAGAAATGCTATCTATATAGG + Intergenic
1108101101 13:46956900-46956922 ATGAATAAAGCTATGAATAAAGG + Intergenic
1108175567 13:47789249-47789271 GTGAGTAATGTGATGAACATGGG - Intergenic
1108872366 13:55003280-55003302 GTAAATTATGCTATTAAAATAGG + Intergenic
1109346706 13:61123944-61123966 GTGAATAATGCTATGAACATAGG - Intergenic
1109500392 13:63229155-63229177 GTGTATAGTTCTATGAGTATTGG + Intergenic
1109927031 13:69157332-69157354 GTGAATAATGCTATGAATATTGG - Intergenic
1110960135 13:81611021-81611043 GAGACTAATTCTATGACTATTGG - Intergenic
1110964118 13:81669686-81669708 GGAAATAATGCTTTGAATGTAGG - Intergenic
1111858832 13:93675060-93675082 GGGAAAAAAGCTATCAATATAGG - Intronic
1112150861 13:96762175-96762197 TTTAAAAATGCTATAAATATTGG + Intronic
1112588955 13:100746278-100746300 GTGAATAATGCTATAAACATTGG - Intergenic
1112702670 13:102029897-102029919 GTGCAGGATGCTAAGAATATAGG + Intronic
1113703788 13:112410850-112410872 GTGAATAATGCTATGAACACAGG - Intronic
1116017142 14:39420941-39420963 CTGAATACTGCTGTTAATATAGG + Intronic
1116224645 14:42133985-42134007 GTGAATAATGTGATGAATATGGG + Intergenic
1116727428 14:48578391-48578413 GTGAATAATGAGATGAATATGGG - Intergenic
1117589502 14:57252321-57252343 GTTAATAATGCTATGGAATTTGG - Intronic
1117869206 14:60181672-60181694 ATGAATAATACTATGAATATTGG + Intergenic
1118561259 14:67086145-67086167 GTGGATAATGTTGTGAATATGGG + Intronic
1118622735 14:67628923-67628945 GTTAATACTGCTGTGAACATGGG - Intronic
1120931784 14:89856064-89856086 GTGAATAATGCTGCAATTATCGG + Intronic
1121084267 14:91133430-91133452 GATAATACTGCTATGAATATTGG + Intronic
1126149664 15:45512202-45512224 GTGAATAGTGCTAGGAAAATTGG - Intronic
1126525521 15:49650038-49650060 GTGAATAATGTTTTAATTATAGG + Exonic
1126531464 15:49715390-49715412 GTCTAGAATGCTATGAGTATTGG + Intergenic
1126994203 15:54421246-54421268 GTAATTAATGTTATGAATAATGG - Intronic
1127686214 15:61347602-61347624 GACAATAATGCTACAAATATAGG - Intergenic
1128081380 15:64859211-64859233 GTGAACAATGCTATGAGCATGGG + Intronic
1128299408 15:66556202-66556224 GTGAATAATGCTAAAAACACGGG - Intronic
1129571742 15:76693532-76693554 GATAATGATGCTATGAACATGGG - Intronic
1130610532 15:85356932-85356954 CTGAATAATGGTATGATCATGGG - Intergenic
1131878782 15:96839892-96839914 ATTAATACTGCTCTGAATATTGG - Intergenic
1133579748 16:7131785-7131807 GTGAATAGTCCTGTGAATATTGG + Intronic
1135902464 16:26475550-26475572 GTGTATAGTTCTATGAATTTTGG - Intergenic
1136507802 16:30716907-30716929 GTGAATAAGGCTATGAACATAGG + Intronic
1137305076 16:47191077-47191099 GCTAATAATGGTATGAATACTGG + Intronic
1137423381 16:48355086-48355108 ATGAGTAATGCTATGAACATGGG + Exonic
1138407030 16:56804259-56804281 GTGAATAATGCTATAAACGTGGG - Intronic
1138502934 16:57459682-57459704 GTTAATGATGCAATGAACATGGG + Exonic
1139171936 16:64640984-64641006 GCCAATAATGCAATGAACATAGG + Intergenic
1139836610 16:69843906-69843928 GGGAATAATGCTTTGAAAAATGG + Intronic
1140215576 16:73004823-73004845 GTTAATATTGATCTGAATATAGG - Intronic
1141203806 16:81917337-81917359 GTGAATGGTGCTATGAACATGGG + Intronic
1142535332 17:611667-611689 GTGAATACTGCTGTGAATATCGG - Intronic
1143993649 17:10988545-10988567 GTGAATAATGCAGTGAACATAGG - Intergenic
1145054464 17:19691300-19691322 GTGAATAGTGCAATAAATATGGG - Intronic
1145828308 17:27893613-27893635 ATGGATTGTGCTATGAATATGGG + Intronic
1145875102 17:28312921-28312943 ATAAAGAATGCTATAAATATTGG + Intergenic
1147973430 17:44233348-44233370 TTTAATAATGTTATGAACATAGG + Intergenic
1148398729 17:47334221-47334243 GTAAATAATGATATGAAAAGAGG - Intronic
1149132550 17:53322427-53322449 GTGAAGGAGGCTATGGATATTGG + Intergenic
1149739054 17:59026020-59026042 GTGAATAATCCAATAAAGATGGG - Intronic
1150418686 17:65008731-65008753 GTGAATAATGTTATCAGTATTGG + Intergenic
1150565410 17:66334805-66334827 ATGAATACTGCTATGAACATGGG - Intronic
1152109728 17:78351328-78351350 CTGAATAGTGCTGTGAATACCGG + Intergenic
1152955981 18:42359-42381 GTGAATGCTGCTATAAACATGGG - Intergenic
1155599279 18:27525474-27525496 ATAAATGATGCTAGGAATATTGG - Intergenic
1157078045 18:44489215-44489237 GTGAATATTGCAAAGAAGATAGG - Intergenic
1157390238 18:47296105-47296127 GTGCATAATTCAATGGATATTGG + Intergenic
1157892541 18:51431781-51431803 GAGATTAATGGTCTGAATATTGG + Intergenic
1158471557 18:57741696-57741718 GTGACTAATGGTATGTGTATTGG - Intronic
1159611614 18:70531945-70531967 GTGAATAATGTTGTGAGTATTGG + Intergenic
1159708409 18:71721920-71721942 GTTTATAATGCTGTGAATCTTGG - Intergenic
1162398220 19:10430306-10430328 GAGAATACTGCTAGGATTATGGG + Intronic
1162702188 19:12524972-12524994 GTGAATGATGCTATGTACACAGG + Intronic
1163379258 19:16954066-16954088 GTGAATAACGCTGTGAACATGGG + Intronic
1163379317 19:16954570-16954592 GTGAATAATGCTGTGAACAGGGG - Intronic
1165524280 19:36340023-36340045 GAGAATAATGTAATGAATGTAGG - Exonic
1165536276 19:36449040-36449062 GTGAGAAACCCTATGAATATAGG - Exonic
1167823373 19:51949912-51949934 GTAGACAATGATATGAATATAGG - Intergenic
1168245094 19:55109075-55109097 GTGAACGATGCTATGAACACGGG + Intronic
925832922 2:7913891-7913913 ATCAATAATGCTATGAATGAAGG - Intergenic
927124201 2:19998428-19998450 GTGAATACTGCTATAAAGCTGGG - Intronic
928043897 2:27907959-27907981 GTGAATAATGCTATTAATATGGG + Intronic
928273129 2:29875066-29875088 GTGAATAATTCTATGAACATTGG - Intronic
930403857 2:50929040-50929062 ATCAATCATGCTATGAATAATGG + Intronic
930671459 2:54155893-54155915 GATAATAATGCTATGAAACTAGG - Intronic
930688662 2:54336154-54336176 GTGTATAATTCTCTGAATTTTGG + Intronic
930903385 2:56534992-56535014 GTGATTAATGCTACGAACCTTGG - Intergenic
930931577 2:56890074-56890096 GTAAATAATGTAATGAACATGGG + Intergenic
931132819 2:59357127-59357149 GTGAATCATGCAATGAATGCTGG + Intergenic
932085214 2:68751659-68751681 GTGAAAAATTATATGCATATAGG + Intronic
932346062 2:70995802-70995824 GTGAATAATGCTATGAATATTGG - Intergenic
932930423 2:76030103-76030125 GTAAATAGTGCTAGGAAAATTGG - Intergenic
933916434 2:86998873-86998895 GTGAATAATTCAATGTTTATTGG + Intronic
934006559 2:87771053-87771075 GTGAATAATTCAATGTTTATTGG - Intronic
934898231 2:98137088-98137110 GGGAACAATGTTATGAATATGGG + Intronic
935770208 2:106411963-106411985 GTGAATAATTCAATGTTTATTGG - Intronic
935968002 2:108500846-108500868 GTGAATAATTCAATGTTTATTGG + Intronic
936131665 2:109849091-109849113 GTGAATAATTCAATGTTTATTGG + Intronic
936213032 2:110522394-110522416 GTGAATAATTCAATGTTTATTGG - Intronic
936422171 2:112376950-112376972 GTGAATAATTCAATGTTTATTGG - Intronic
937396135 2:121536498-121536520 GATAATGATGCTGTGAATATGGG - Intronic
938968497 2:136409256-136409278 GTGAATTCTGCTGTGAACATGGG + Intergenic
938982699 2:136541667-136541689 GGGAATTATGCTATGGCTATTGG + Intergenic
941138618 2:161747736-161747758 GTGAATGCTGCAATGAATATAGG + Intronic
943949758 2:194117936-194117958 GTCAATGCTGCTATGAATGTAGG - Intergenic
945520598 2:210822643-210822665 GTGAAAAATTCTAAGAATTTTGG - Intergenic
945638004 2:212383311-212383333 CTGATTAATTCTAAGAATATAGG + Intronic
946981440 2:225220391-225220413 GTGAATAGTGTAATGAACATAGG + Intergenic
948172261 2:235914331-235914353 TTGATTAATGCTCTGGATATTGG + Intronic
948804999 2:240449989-240450011 GTGAATAATGCTGTGAGCATGGG + Intronic
1168744946 20:231117-231139 GTGAATAATGGCATGAGTTTGGG + Intergenic
1169185180 20:3609618-3609640 GTGAATAATGCTATCAACATTGG - Intronic
1169560486 20:6794692-6794714 GTGATTAATGCCATGGAAATAGG - Intergenic
1171003062 20:21434161-21434183 ATGAAAAATGCCATCAATATAGG - Intergenic
1172075162 20:32290498-32290520 GTGAATAATGCTATGGGCAGAGG - Intronic
1172237505 20:33388387-33388409 GATAATAGTGCTATGAACATGGG - Intronic
1174797668 20:53535902-53535924 GTGAATAAAGTTATGTATTTAGG + Intergenic
1175209848 20:57346886-57346908 GTAACTCATGCTAAGAATATAGG + Intergenic
1175617689 20:60415567-60415589 ATAAATGATGCTATGAATATTGG - Intergenic
1176133896 20:63510730-63510752 GTGGATCATGCTTTTAATATTGG + Intergenic
1177034998 21:16031620-16031642 GTGAATCAGGCTATAAATAGAGG - Intergenic
1177475914 21:21622436-21622458 GAAAATGCTGCTATGAATATTGG + Intergenic
1177741701 21:25162004-25162026 GTGACAAATGCTATGAGTAAAGG - Intergenic
1177884153 21:26728677-26728699 GTTAACAATGAAATGAATATGGG - Intergenic
949574057 3:5321652-5321674 CTAAATAATGCCAAGAATATTGG - Intergenic
949772356 3:7593239-7593261 GAAAATAAGGCTATGAATATGGG - Intronic
949956425 3:9272696-9272718 AGTAATACTGCTATGAATATTGG + Intronic
952114913 3:30167354-30167376 ATAAATAATGCAAAGAATATTGG + Intergenic
952568008 3:34681376-34681398 GGGAAAAAGGCAATGAATATGGG + Intergenic
953542008 3:43828710-43828732 GTGATTATTGCTAAAAATATGGG + Intergenic
953964275 3:47290889-47290911 GTGAATAATGCTGTTAAATTTGG + Intronic
954311121 3:49768241-49768263 GTGAATAATGCTGTGAACATTGG - Intronic
954913074 3:54124480-54124502 GGGAATAATTCTCTGAAAATGGG + Intronic
956063677 3:65374639-65374661 ATGAATAATACAATGAGTATTGG + Intronic
957281668 3:78157960-78157982 GGTAATAATTCTATGAATCTGGG - Intergenic
957326343 3:78699952-78699974 GTTAAGATTGCTATGAAAATAGG - Intronic
958259188 3:91359893-91359915 GTGATTAATGCTATTATTACAGG - Intergenic
958544489 3:95525211-95525233 GTGAAAAATGTTATTAATAATGG - Intergenic
958664741 3:97121936-97121958 GAAAATAATGTGATGAATATGGG - Intronic
959740866 3:109718009-109718031 GTGAATGAAGCAATGAACATGGG - Intergenic
959990416 3:112625194-112625216 GTGAAAAATGGTATCAGTATAGG - Intronic
960010660 3:112831421-112831443 GTGAAGAATACAATGACTATTGG + Intronic
960135565 3:114100768-114100790 GTGAATAATGGGATGAATGATGG - Intergenic
960332093 3:116373117-116373139 GTGAATAATGCTATTAACGTGGG - Intronic
960768409 3:121164590-121164612 GTGAATATTGTCATGAACATGGG - Intronic
961950978 3:130748506-130748528 TAGACTAATGCTATGAACATAGG - Intergenic
963208891 3:142666587-142666609 GTGAATAATGCTATGAACATGGG + Intronic
963754581 3:149220944-149220966 GTGAATATTGCTTTCAATAAGGG + Intronic
967141869 3:186568346-186568368 GTGAAAAATGCTATGAAAATTGG + Intronic
968989188 4:3897456-3897478 GTTAATATTGATATTAATATCGG + Intergenic
969786673 4:9463593-9463615 AATAATACTGCTATGAATATGGG - Intergenic
969918319 4:10511803-10511825 GTAAATAATGTTATGAACATGGG + Intronic
970502749 4:16694720-16694742 GAGAATAAAGCTATGACTCTTGG - Intronic
970752872 4:19386288-19386310 GGTAAAAATGCTATGAAAATGGG - Intergenic
971458194 4:26864207-26864229 CTATATAATGTTATGAATATTGG - Intronic
972062637 4:34896682-34896704 GTGATTAATGCAATGAACAAGGG + Intergenic
974417793 4:61632944-61632966 GTGAATAACCCCATTAATATTGG - Intronic
974515589 4:62904379-62904401 GTGAATATTTGTATGAATGTAGG + Intergenic
977327168 4:95590044-95590066 GTGAATGATGCTAAGATTATGGG + Intergenic
978360112 4:107922495-107922517 GTGAATAATACTATGAACACTGG - Intergenic
978865951 4:113511792-113511814 ATGAATAATGCTACGAATTGAGG - Intronic
979080420 4:116332016-116332038 GTAAACAATGCTATTAAAATGGG + Intergenic
979862401 4:125709798-125709820 ATGAATACTTCTCTGAATATGGG + Intergenic
979937494 4:126716148-126716170 GTGAAAAATGCACTGACTATAGG - Intergenic
980967971 4:139541938-139541960 GTGAATAGTGCAATAAACATGGG - Intronic
981192825 4:141883406-141883428 ATGAATAATGCAGTGAAAATGGG + Intergenic
981894965 4:149787605-149787627 ATAAATGATGCTATGAAAATTGG + Intergenic
981911765 4:149990209-149990231 GTGAATAATGCTATGAGCATGGG - Intergenic
982446185 4:155493033-155493055 TTGAACAATGCTGTGAAAATGGG + Intergenic
983295584 4:165863926-165863948 GTGAATAATACTATGCTTTTAGG + Intergenic
983695936 4:170530822-170530844 GTAAATGATGTTATGAATATTGG - Intergenic
985477565 5:87078-87100 GTGATTAATGCCATGAATGTTGG + Intergenic
986424799 5:7620581-7620603 GTGAAAAATGCTAAGGAGATGGG + Intronic
986482966 5:8207347-8207369 GTGAATAATGCAATGAGCATGGG + Intergenic
987803779 5:22734464-22734486 GTGAAAAATGCTATAAACATAGG - Intronic
988259360 5:28863850-28863872 GTAAATAATAATATGAATAATGG + Intergenic
988426464 5:31071329-31071351 GTCAATAATGCTTAGAATAGTGG - Intergenic
988506503 5:31828135-31828157 ATGAATCATGCTGTGAACATTGG + Intronic
989476326 5:41878027-41878049 GTGAATAGTGCAATGAACATTGG - Intergenic
989765730 5:45081354-45081376 GTGAACAATGCAATAAACATGGG + Intergenic
990131228 5:52587676-52587698 ATGAATAATGGCATGCATATAGG + Intergenic
990385932 5:55262585-55262607 CAGAATAATGCTCTGAATACTGG + Intronic
990880759 5:60535130-60535152 GTGAATAATGCTTTGAAACATGG + Intergenic
994319171 5:98370411-98370433 GTGAATAATGCTAGGAACGTCGG + Intergenic
994965142 5:106660034-106660056 GGGAATTATCCTATGAATAATGG + Intergenic
995985716 5:118170102-118170124 ATCAATGCTGCTATGAATATTGG + Intergenic
996189025 5:120515642-120515664 GTAAAAAATGCTATTAATCTGGG - Intronic
997242439 5:132317588-132317610 ATGAATAATGCTATGAACATTGG + Intronic
997671288 5:135675427-135675449 GTAAATGATGCTAGGAAGATTGG - Intergenic
997810805 5:136966466-136966488 CAAAATATTGCTATGAATATTGG + Intergenic
997864253 5:137447095-137447117 GTTAATGCTGCTATGAATATGGG + Intronic
998553113 5:143096717-143096739 GTGAAGAATACAATGACTATTGG + Intronic
999022096 5:148177660-148177682 GTGTCTGATGCTAAGAATATGGG - Intergenic
999437935 5:151578668-151578690 GTGAATAATGCAGTAAAGATGGG - Intergenic
1000142726 5:158421946-158421968 GTGAATAGTGATTTGAAAATTGG + Intergenic
1000642914 5:163725229-163725251 GTAAAAACTGCTATGAAAATGGG + Intergenic
1004539227 6:16533869-16533891 GGGAATAGTGCTATGCAAATAGG - Intronic
1005062563 6:21790668-21790690 GTGAATACCTCTATGAACATGGG + Intergenic
1005792352 6:29316951-29316973 GTTTATAATGCTATGACTTTTGG - Intergenic
1007650131 6:43414105-43414127 CTGAATAATGCTATTGTTATGGG - Intergenic
1007953119 6:45890612-45890634 GTGAATGCTGCAATGAACATGGG - Intergenic
1008343753 6:50400412-50400434 GTGAATAGTGCAATAAACATGGG + Intergenic
1009184596 6:60559476-60559498 GTGATTAATGCTATTATTACAGG + Intergenic
1009265461 6:61549085-61549107 GTGAATAATGCAATGACCTTAGG + Intergenic
1009653001 6:66500144-66500166 GTGAATTATGCAATGAACATGGG + Intergenic
1010173440 6:72998972-72998994 GTGAATGATGCAATGAAGAAAGG - Intronic
1011720644 6:90152878-90152900 GTGAATATTACTATGGATAATGG + Intronic
1012198146 6:96370571-96370593 GAGAATAATGCAATGACTAGGGG + Intergenic
1012265004 6:97131152-97131174 GTGCATAATGGTAGTAATATAGG - Intronic
1012388516 6:98709562-98709584 GTGAAGAAAGATATGAAGATGGG - Intergenic
1012468838 6:99547354-99547376 GTGGACAATGCTATTAACATGGG + Intronic
1012538466 6:100328655-100328677 GTGAAAACTGCTGTGAACATAGG - Intergenic
1012579533 6:100849779-100849801 GTTAATAATGTAATGAATACTGG + Intronic
1013733249 6:113194975-113194997 GTTAATAATGATATCAGTATTGG + Intergenic
1013799524 6:113925779-113925801 ATGAATAATGGACTGAATATAGG + Intergenic
1014190463 6:118489836-118489858 GTGAATACTGCTAGGAACATGGG - Intronic
1014634383 6:123826785-123826807 AATAATACTGCTATGAATATAGG + Intronic
1014952292 6:127570575-127570597 GTTAACAATTCTAGGAATATAGG - Intronic
1015069882 6:129079105-129079127 GTTCTTAATGCTATGAACATGGG + Intronic
1015324553 6:131909440-131909462 GTGAACAATGCTGTGAACATGGG - Intergenic
1016218375 6:141631828-141631850 GTGAATAATGTAATAAATGTGGG - Intergenic
1017335777 6:153258117-153258139 TTGAATAAACCAATGAATATAGG + Intergenic
1017749241 6:157474356-157474378 GATAATACTGCAATGAATATGGG + Intronic
1018035629 6:159878845-159878867 ATGAATTGTGCTATGAATCTGGG + Intergenic
1019219101 6:170461073-170461095 GTGGATGTTGCTATGAATTTTGG - Intergenic
1019699406 7:2466997-2467019 TGGAAAAATGCAATGAATATTGG + Intergenic
1020748856 7:12113043-12113065 TTGAATAATGAAATGAATATAGG - Intergenic
1021119979 7:16788237-16788259 GTGGATAATGCTATGAGCGTGGG + Intergenic
1021190779 7:17617448-17617470 GTGAAGAATGTTATGAATCTTGG + Intergenic
1024038939 7:45534410-45534432 ATGAATAATGGAATTAATATAGG + Intergenic
1024453452 7:49576227-49576249 GTTAATTATGATATGAATTTAGG - Intergenic
1026544446 7:71309641-71309663 AGGAATATTCCTATGAATATAGG + Intronic
1027528817 7:79304508-79304530 GAGTAAAATGCTATGTATATCGG - Intronic
1027642219 7:80750326-80750348 GAGAATCCTGCTATGAACATGGG - Intronic
1027660149 7:80979129-80979151 GAGAATAATGATAAGAATAAGGG - Intergenic
1028576751 7:92360533-92360555 GTGAATAATACTGTGAATGTTGG + Intronic
1028708627 7:93880973-93880995 GTGAATAATGCAGTGAACATGGG - Intronic
1028899919 7:96086060-96086082 GTGAATAATTCTATACATACTGG - Intronic
1029062906 7:97816854-97816876 ATGAAAAATGCTAGGAATAGGGG + Intergenic
1031370031 7:120954108-120954130 TTGAACAATTCTATGAACATTGG - Intronic
1031510719 7:122646002-122646024 GTGAATAATGCTGAGATTAAAGG + Intronic
1032949764 7:136894023-136894045 GTGAATAATACTAGGACTCTAGG - Intronic
1032950548 7:136905342-136905364 ATGAATAATATAATGAATATGGG - Intronic
1033383352 7:140846200-140846222 ATCAATAATGCTGTGAACATGGG - Intronic
1036048810 8:5173025-5173047 GTGAAGAATGCTATGGAGAGAGG + Intergenic
1038082417 8:24154044-24154066 GAGAATAATGCTACAAACATGGG - Intergenic
1038222940 8:25627960-25627982 GTGGATAATGCTATGACAACTGG - Intergenic
1039731881 8:40288599-40288621 GTAAATAATGTGATGAAAATGGG + Intergenic
1039735799 8:40331222-40331244 GTGAGAAATGCAATGACTATTGG - Intergenic
1039761991 8:40586759-40586781 TTGCTGAATGCTATGAATATGGG + Intronic
1041940144 8:63378055-63378077 GTGAATAATGCTATGAACATGGG + Intergenic
1042858107 8:73287516-73287538 GTAATTAATGCTATGAAAAAAGG + Intergenic
1044373372 8:91441019-91441041 TTAAATAATGTTATTAATATAGG + Intergenic
1044404118 8:91807853-91807875 GTGATTGGTGCTATGAATACAGG + Intergenic
1047272478 8:123375562-123375584 ATGAATAATGATATGAATGTAGG - Intronic
1047613281 8:126541841-126541863 GGGAATAATGCTATGAACATTGG - Intergenic
1048903397 8:139062220-139062242 GTGAATAATGCAATGTGCATGGG - Intergenic
1050258880 9:3820414-3820436 GTGAACAATGCTTTGAACACTGG + Intergenic
1050794006 9:9513924-9513946 GTGAATAAGGCTGTTAAGATGGG + Intronic
1051254399 9:15198045-15198067 ATGAAAAATGGTAAGAATATGGG + Intronic
1051375334 9:16396719-16396741 GTGAATAGTGCTATGAGGAAAGG - Intergenic
1052021029 9:23525347-23525369 GTGTATAATGCTATAAATGTGGG - Intergenic
1052228504 9:26118971-26118993 GTTAATAATGCCATTAATATTGG + Intergenic
1052486044 9:29101400-29101422 TTGAATAATTCTCTGAATGTGGG - Intergenic
1053027860 9:34745610-34745632 ATAAATAATGCTATCAGTATGGG - Intergenic
1055096085 9:72415577-72415599 GGGAATATTGTTAGGAATATGGG + Intergenic
1056574051 9:87841732-87841754 GTGAATAGAAATATGAATATAGG - Intergenic
1057370466 9:94467865-94467887 GTGATTCCTTCTATGAATATGGG - Intergenic
1057822915 9:98347020-98347042 GTGAATAATGCAATAAATATAGG + Intronic
1058456695 9:105144399-105144421 ATGAATAATGCTATGAACATAGG - Intergenic
1060178974 9:121518650-121518672 GTGAATAATGTCATGAGCATGGG - Intergenic
1060746353 9:126135587-126135609 GTGAATTATCCTATGAGTACAGG - Intergenic
1186096410 X:6107404-6107426 GTGAAAGATGGTGTGAATATGGG + Intronic
1186232822 X:7474182-7474204 GTGATTATTGCCATGATTATAGG + Intergenic
1186381025 X:9059182-9059204 GTGAATAATGCAATAAATATGGG - Intronic
1186942942 X:14530994-14531016 AGTAATAATGCTATGAATACTGG + Intronic
1186994421 X:15104549-15104571 GTGAATAATGCTATGAACATGGG - Intergenic
1187220606 X:17322354-17322376 GTGAATAATTATATTATTATGGG - Intergenic
1187777943 X:22784808-22784830 TTGGAAAATGCTACGAATATTGG - Intergenic
1188511460 X:30940898-30940920 ATGAATAATGCTAAGAACGTTGG + Intronic
1189154977 X:38747805-38747827 CTGAAAAATGCTATTAATATGGG - Intergenic
1189901109 X:45707254-45707276 GATAATGCTGCTATGAATATTGG - Intergenic
1192771103 X:74192282-74192304 GTGAATAATGTAAATAATATGGG + Intergenic
1193104451 X:77653245-77653267 AATAATACTGCTATGAATATGGG - Intronic
1193443784 X:81575101-81575123 GTGAATAATGCTAAGAAGGTGGG - Intergenic
1193669717 X:84369358-84369380 GTGAATAATGGTATGCATATAGG + Intronic
1193934376 X:87598411-87598433 GTGAATAGAGATATAAATATAGG + Intronic
1194393884 X:93355770-93355792 GTAAATAGTGCTGTAAATATGGG - Intergenic
1195072988 X:101299000-101299022 ATGAATGCTTCTATGAATATTGG + Intergenic
1195490197 X:105459693-105459715 ATGCTTAATGCTATTAATATTGG - Intronic
1196756676 X:119163326-119163348 GTGAATAATGCTGTGAACATGGG - Intergenic
1197643693 X:128994107-128994129 GTGAATACTGCAATAAACATGGG - Intergenic
1197909860 X:131470280-131470302 GTGAATAATGTAATGAACATGGG + Intergenic
1197968383 X:132090012-132090034 ATGAATAATGCTATAAGCATTGG - Intronic
1199010573 X:142753940-142753962 TTTAATTTTGCTATGAATATAGG - Intergenic
1199307490 X:146284047-146284069 AATAATATTGCTATGAATATTGG + Intergenic
1200314158 X:155114159-155114181 GTGAATAATGCTGTGAACATAGG - Intronic
1200779041 Y:7197744-7197766 GGGAAAAAGGCAATGAATATAGG + Intergenic
1201476278 Y:14385338-14385360 GTGAATATTTCTATGCACATTGG - Intergenic