ID: 1109933294

View in Genome Browser
Species Human (GRCh38)
Location 13:69245202-69245224
Sequence AGTTATTTGCAGATAGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109933290_1109933294 16 Left 1109933290 13:69245163-69245185 CCCGATAGCAGGCCAAGAACTGT No data
Right 1109933294 13:69245202-69245224 AGTTATTTGCAGATAGTGTCAGG No data
1109933291_1109933294 15 Left 1109933291 13:69245164-69245186 CCGATAGCAGGCCAAGAACTGTT No data
Right 1109933294 13:69245202-69245224 AGTTATTTGCAGATAGTGTCAGG No data
1109933293_1109933294 4 Left 1109933293 13:69245175-69245197 CCAAGAACTGTTTCTCAAGAGGA No data
Right 1109933294 13:69245202-69245224 AGTTATTTGCAGATAGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109933294 Original CRISPR AGTTATTTGCAGATAGTGTC AGG Intergenic
No off target data available for this crispr