ID: 1109936334

View in Genome Browser
Species Human (GRCh38)
Location 13:69289701-69289723
Sequence ACCCCTTTGCTGTAACAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109936329_1109936334 8 Left 1109936329 13:69289670-69289692 CCAAGAACGCTCTCTAGGGGCCT No data
Right 1109936334 13:69289701-69289723 ACCCCTTTGCTGTAACAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109936334 Original CRISPR ACCCCTTTGCTGTAACAAAA TGG Intergenic
No off target data available for this crispr