ID: 1109944716

View in Genome Browser
Species Human (GRCh38)
Location 13:69418990-69419012
Sequence ATGTCTATTAACAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109944716_1109944721 13 Left 1109944716 13:69418990-69419012 CCATCCTCCTTGTTAATAGACAT No data
Right 1109944721 13:69419026-69419048 AACACACTTGCCCATAAAGTAGG No data
1109944716_1109944724 28 Left 1109944716 13:69418990-69419012 CCATCCTCCTTGTTAATAGACAT No data
Right 1109944724 13:69419041-69419063 AAAGTAGGAATGTGCAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109944716 Original CRISPR ATGTCTATTAACAAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr