ID: 1109945307

View in Genome Browser
Species Human (GRCh38)
Location 13:69424176-69424198
Sequence CTTATCGCAGCCAAAAACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109945299_1109945307 7 Left 1109945299 13:69424146-69424168 CCTGCCCCCACCTGATGGTCTTT 0: 36
1: 207
2: 380
3: 363
4: 508
Right 1109945307 13:69424176-69424198 CTTATCGCAGCCAAAAACAAAGG No data
1109945298_1109945307 8 Left 1109945298 13:69424145-69424167 CCCTGCCCCCACCTGATGGTCTT 0: 37
1: 172
2: 328
3: 322
4: 485
Right 1109945307 13:69424176-69424198 CTTATCGCAGCCAAAAACAAAGG No data
1109945300_1109945307 3 Left 1109945300 13:69424150-69424172 CCCCCACCTGATGGTCTTTCTCT 0: 47
1: 167
2: 311
3: 355
4: 487
Right 1109945307 13:69424176-69424198 CTTATCGCAGCCAAAAACAAAGG No data
1109945302_1109945307 1 Left 1109945302 13:69424152-69424174 CCCACCTGATGGTCTTTCTCTAC 0: 82
1: 197
2: 319
3: 347
4: 413
Right 1109945307 13:69424176-69424198 CTTATCGCAGCCAAAAACAAAGG No data
1109945296_1109945307 13 Left 1109945296 13:69424140-69424162 CCTAACCCTGCCCCCACCTGATG 0: 58
1: 224
2: 292
3: 355
4: 682
Right 1109945307 13:69424176-69424198 CTTATCGCAGCCAAAAACAAAGG No data
1109945304_1109945307 -3 Left 1109945304 13:69424156-69424178 CCTGATGGTCTTTCTCTACCCTT No data
Right 1109945307 13:69424176-69424198 CTTATCGCAGCCAAAAACAAAGG No data
1109945303_1109945307 0 Left 1109945303 13:69424153-69424175 CCACCTGATGGTCTTTCTCTACC 0: 53
1: 153
2: 255
3: 285
4: 420
Right 1109945307 13:69424176-69424198 CTTATCGCAGCCAAAAACAAAGG No data
1109945301_1109945307 2 Left 1109945301 13:69424151-69424173 CCCCACCTGATGGTCTTTCTCTA 0: 55
1: 180
2: 347
3: 391
4: 508
Right 1109945307 13:69424176-69424198 CTTATCGCAGCCAAAAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109945307 Original CRISPR CTTATCGCAGCCAAAAACAA AGG Intergenic
No off target data available for this crispr