ID: 1109951025

View in Genome Browser
Species Human (GRCh38)
Location 13:69502205-69502227
Sequence ACCTTTTGAGAGACAGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109951025_1109951028 27 Left 1109951025 13:69502205-69502227 CCAAGAGCTGTCTCTCAAAAGGT No data
Right 1109951028 13:69502255-69502277 GCCTTGCTCCAAAATCCTAGAGG 0: 143
1: 187
2: 148
3: 132
4: 240
1109951025_1109951027 5 Left 1109951025 13:69502205-69502227 CCAAGAGCTGTCTCTCAAAAGGT No data
Right 1109951027 13:69502233-69502255 GTTATCTGCAGAAGATAGCAGGG No data
1109951025_1109951026 4 Left 1109951025 13:69502205-69502227 CCAAGAGCTGTCTCTCAAAAGGT No data
Right 1109951026 13:69502232-69502254 AGTTATCTGCAGAAGATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109951025 Original CRISPR ACCTTTTGAGAGACAGCTCT TGG (reversed) Intergenic
No off target data available for this crispr