ID: 1109951026

View in Genome Browser
Species Human (GRCh38)
Location 13:69502232-69502254
Sequence AGTTATCTGCAGAAGATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109951025_1109951026 4 Left 1109951025 13:69502205-69502227 CCAAGAGCTGTCTCTCAAAAGGT No data
Right 1109951026 13:69502232-69502254 AGTTATCTGCAGAAGATAGCAGG No data
1109951023_1109951026 15 Left 1109951023 13:69502194-69502216 CCAGTAACAGGCCAAGAGCTGTC 0: 162
1: 189
2: 129
3: 114
4: 178
Right 1109951026 13:69502232-69502254 AGTTATCTGCAGAAGATAGCAGG No data
1109951021_1109951026 22 Left 1109951021 13:69502187-69502209 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 1109951026 13:69502232-69502254 AGTTATCTGCAGAAGATAGCAGG No data
1109951022_1109951026 16 Left 1109951022 13:69502193-69502215 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 1109951026 13:69502232-69502254 AGTTATCTGCAGAAGATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109951026 Original CRISPR AGTTATCTGCAGAAGATAGC AGG Intergenic
No off target data available for this crispr