ID: 1109957177

View in Genome Browser
Species Human (GRCh38)
Location 13:69583402-69583424
Sequence GTTCATTTCAGCATCTATGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109957175_1109957177 -4 Left 1109957175 13:69583383-69583405 CCAGTTTTCTAGATGACCTGTTC No data
Right 1109957177 13:69583402-69583424 GTTCATTTCAGCATCTATGTCGG No data
1109957172_1109957177 5 Left 1109957172 13:69583374-69583396 CCTAATTCCCCAGTTTTCTAGAT No data
Right 1109957177 13:69583402-69583424 GTTCATTTCAGCATCTATGTCGG No data
1109957173_1109957177 -2 Left 1109957173 13:69583381-69583403 CCCCAGTTTTCTAGATGACCTGT No data
Right 1109957177 13:69583402-69583424 GTTCATTTCAGCATCTATGTCGG No data
1109957174_1109957177 -3 Left 1109957174 13:69583382-69583404 CCCAGTTTTCTAGATGACCTGTT No data
Right 1109957177 13:69583402-69583424 GTTCATTTCAGCATCTATGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109957177 Original CRISPR GTTCATTTCAGCATCTATGT CGG Intergenic
No off target data available for this crispr