ID: 1109958777

View in Genome Browser
Species Human (GRCh38)
Location 13:69603683-69603705
Sequence CTGAATATACAAATGCACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109958777_1109958779 16 Left 1109958777 13:69603683-69603705 CCACTGTGCATTTGTATATTCAG No data
Right 1109958779 13:69603722-69603744 ACACATATTTAAGGCAACACTGG No data
1109958777_1109958778 7 Left 1109958777 13:69603683-69603705 CCACTGTGCATTTGTATATTCAG No data
Right 1109958778 13:69603713-69603735 TAGCTTGAAACACATATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109958777 Original CRISPR CTGAATATACAAATGCACAG TGG (reversed) Intergenic
No off target data available for this crispr