ID: 1109960667

View in Genome Browser
Species Human (GRCh38)
Location 13:69625002-69625024
Sequence AAATATACACAACCTGATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109960664_1109960667 25 Left 1109960664 13:69624954-69624976 CCCAACATTTATTCATGGCAAAA No data
Right 1109960667 13:69625002-69625024 AAATATACACAACCTGATAATGG No data
1109960665_1109960667 24 Left 1109960665 13:69624955-69624977 CCAACATTTATTCATGGCAAAAC No data
Right 1109960667 13:69625002-69625024 AAATATACACAACCTGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109960667 Original CRISPR AAATATACACAACCTGATAA TGG Intergenic
No off target data available for this crispr