ID: 1109961332

View in Genome Browser
Species Human (GRCh38)
Location 13:69636571-69636593
Sequence TGAACCCCCTGTCAAAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109961327_1109961332 16 Left 1109961327 13:69636532-69636554 CCCTGTTGGCTAGGCTGGTCTCA 0: 1135
1: 37933
2: 109792
3: 174519
4: 183840
Right 1109961332 13:69636571-69636593 TGAACCCCCTGTCAAAGTGCTGG No data
1109961328_1109961332 15 Left 1109961328 13:69636533-69636555 CCTGTTGGCTAGGCTGGTCTCAA 0: 18
1: 530
2: 1695
3: 2792
4: 3549
Right 1109961332 13:69636571-69636593 TGAACCCCCTGTCAAAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109961332 Original CRISPR TGAACCCCCTGTCAAAGTGC TGG Intergenic
No off target data available for this crispr