ID: 1109961760

View in Genome Browser
Species Human (GRCh38)
Location 13:69640024-69640046
Sequence AGGGAGAGCACAATGATTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109961760_1109961771 30 Left 1109961760 13:69640024-69640046 CCCGCAATCATTGTGCTCTCCCT No data
Right 1109961771 13:69640077-69640099 CATGGCCACTGCTTGGGGATGGG No data
1109961760_1109961768 24 Left 1109961760 13:69640024-69640046 CCCGCAATCATTGTGCTCTCCCT No data
Right 1109961768 13:69640071-69640093 ATGCAACATGGCCACTGCTTGGG No data
1109961760_1109961769 25 Left 1109961760 13:69640024-69640046 CCCGCAATCATTGTGCTCTCCCT No data
Right 1109961769 13:69640072-69640094 TGCAACATGGCCACTGCTTGGGG No data
1109961760_1109961767 23 Left 1109961760 13:69640024-69640046 CCCGCAATCATTGTGCTCTCCCT No data
Right 1109961767 13:69640070-69640092 TATGCAACATGGCCACTGCTTGG No data
1109961760_1109961766 12 Left 1109961760 13:69640024-69640046 CCCGCAATCATTGTGCTCTCCCT No data
Right 1109961766 13:69640059-69640081 CAGATTCTCTCTATGCAACATGG No data
1109961760_1109961770 29 Left 1109961760 13:69640024-69640046 CCCGCAATCATTGTGCTCTCCCT No data
Right 1109961770 13:69640076-69640098 ACATGGCCACTGCTTGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109961760 Original CRISPR AGGGAGAGCACAATGATTGC GGG (reversed) Intergenic
No off target data available for this crispr