ID: 1109961766

View in Genome Browser
Species Human (GRCh38)
Location 13:69640059-69640081
Sequence CAGATTCTCTCTATGCAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109961761_1109961766 11 Left 1109961761 13:69640025-69640047 CCGCAATCATTGTGCTCTCCCTC No data
Right 1109961766 13:69640059-69640081 CAGATTCTCTCTATGCAACATGG No data
1109961763_1109961766 -8 Left 1109961763 13:69640044-69640066 CCTCCCTCAGATGCACAGATTCT No data
Right 1109961766 13:69640059-69640081 CAGATTCTCTCTATGCAACATGG No data
1109961759_1109961766 24 Left 1109961759 13:69640012-69640034 CCAACGCAAAGTCCCGCAATCAT No data
Right 1109961766 13:69640059-69640081 CAGATTCTCTCTATGCAACATGG No data
1109961762_1109961766 -7 Left 1109961762 13:69640043-69640065 CCCTCCCTCAGATGCACAGATTC No data
Right 1109961766 13:69640059-69640081 CAGATTCTCTCTATGCAACATGG No data
1109961760_1109961766 12 Left 1109961760 13:69640024-69640046 CCCGCAATCATTGTGCTCTCCCT No data
Right 1109961766 13:69640059-69640081 CAGATTCTCTCTATGCAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109961766 Original CRISPR CAGATTCTCTCTATGCAACA TGG Intergenic
No off target data available for this crispr