ID: 1109961768

View in Genome Browser
Species Human (GRCh38)
Location 13:69640071-69640093
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109961765_1109961768 0 Left 1109961765 13:69640048-69640070 CCTCAGATGCACAGATTCTCTCT No data
Right 1109961768 13:69640071-69640093 ATGCAACATGGCCACTGCTTGGG No data
1109961762_1109961768 5 Left 1109961762 13:69640043-69640065 CCCTCCCTCAGATGCACAGATTC No data
Right 1109961768 13:69640071-69640093 ATGCAACATGGCCACTGCTTGGG No data
1109961761_1109961768 23 Left 1109961761 13:69640025-69640047 CCGCAATCATTGTGCTCTCCCTC No data
Right 1109961768 13:69640071-69640093 ATGCAACATGGCCACTGCTTGGG No data
1109961763_1109961768 4 Left 1109961763 13:69640044-69640066 CCTCCCTCAGATGCACAGATTCT No data
Right 1109961768 13:69640071-69640093 ATGCAACATGGCCACTGCTTGGG No data
1109961760_1109961768 24 Left 1109961760 13:69640024-69640046 CCCGCAATCATTGTGCTCTCCCT No data
Right 1109961768 13:69640071-69640093 ATGCAACATGGCCACTGCTTGGG No data
1109961764_1109961768 1 Left 1109961764 13:69640047-69640069 CCCTCAGATGCACAGATTCTCTC No data
Right 1109961768 13:69640071-69640093 ATGCAACATGGCCACTGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109961768 Original CRISPR ATGCAACATGGCCACTGCTT GGG Intergenic
No off target data available for this crispr