ID: 1109966445

View in Genome Browser
Species Human (GRCh38)
Location 13:69704275-69704297
Sequence TAAGGTAAAAAGAAGGGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 348}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109966445 Original CRISPR TAAGGTAAAAAGAAGGGTCA AGG (reversed) Intronic
900779647 1:4609477-4609499 TAAGGTCACAAGGAGGGTCGGGG - Intergenic
901246855 1:7738479-7738501 ACAGGTAAAAAGCAGGGACAGGG + Exonic
903892067 1:26576410-26576432 TAAGGGAAACAGAAGATTCAAGG + Intergenic
904153424 1:28462344-28462366 AAAGGTGAAAAGAAAGGCCATGG - Intronic
904716970 1:32475742-32475764 GAAGGTAAGAAGAGGGGACAGGG + Intronic
905063772 1:35162220-35162242 TAAGGTAAAATGAAGGCATACGG - Intergenic
905749009 1:40445448-40445470 TATGGTAGAAGGAAGGGACAGGG + Intergenic
906186711 1:43867711-43867733 TAAGACAACAAGAAGGGGCAGGG - Intronic
908882401 1:68746833-68746855 TAAGGTAATGAGAAGGGTTTGGG + Intergenic
908988643 1:70057305-70057327 TAAGGAAAGAAAAATGGTCATGG + Intronic
909007382 1:70292584-70292606 TTAGGTTAAAAAAAGTGTCAAGG + Intronic
909198605 1:72659104-72659126 TAAGGGAAAAAGAAGTGGCAAGG - Intergenic
910150350 1:84135052-84135074 TAAGGTAAAAAGGAGCGAGATGG + Intronic
911776341 1:101818101-101818123 AAAGGTAAAAGGAAGAGTCAAGG - Intronic
912575284 1:110665386-110665408 TAAGAGAAAAAGAAGAATCAAGG + Intergenic
912789629 1:112639416-112639438 TAAGTTAAAAAGCAGGGTGAGGG - Intronic
913187393 1:116381217-116381239 TTAGGGAAAAACAAAGGTCATGG - Intronic
914345092 1:146792126-146792148 TAAAGTAGAAAGAAGGGGCCAGG - Intergenic
915431601 1:155871261-155871283 TGAGGAAAAAAGATGGGACAGGG - Intronic
916182150 1:162094653-162094675 TAAAGTCAAAAGAAAGGTGATGG - Intronic
916908311 1:169314838-169314860 TAAAGTAAAAAGAATGGAAAAGG + Intronic
917384928 1:174462012-174462034 TAAGGTATACAGAAGGTTCTTGG - Intronic
919002498 1:191851133-191851155 AAAGGTAAAAACAAGTGACAAGG - Intergenic
919443932 1:197677484-197677506 TCAGGGAAAAGGAGGGGTCATGG - Intronic
920637166 1:207714775-207714797 TAAGAAAAAAAGAAGGGTCAGGG - Intronic
921124495 1:212165065-212165087 TACTGTAAGAAGAAGGATCAAGG - Intergenic
922356721 1:224783306-224783328 GAAGGAAAACAGAAGGGGCAAGG + Intergenic
923930538 1:238690269-238690291 TAGGGGAAAAAGAAGGTTAAGGG - Intergenic
924026299 1:239836579-239836601 TCAGGTGAAAAGGAGGTTCAAGG - Intronic
924186239 1:241494206-241494228 GAAGGTGAAAAGAATGGCCAAGG - Intergenic
1063087593 10:2833462-2833484 TGAGGCAAAAAGAAGAATCACGG - Intergenic
1063153460 10:3356899-3356921 TAAGGTACAATGAAGTGTCTGGG + Intergenic
1064365958 10:14708051-14708073 TAAGGTGAAGAGAATGGACAGGG - Intronic
1064381375 10:14844628-14844650 TAAGGAAATAAGAAGTGCCAGGG + Intronic
1064497652 10:15930658-15930680 TAATGTACAATGAAGGGACAAGG - Intergenic
1066308480 10:34171208-34171230 AAAGGCAAAAAGAAGGTTAACGG + Intronic
1066385647 10:34939183-34939205 TATGGTCAAATGAGGGGTCAGGG + Intergenic
1067324800 10:45257317-45257339 AAATATAAAAAGAAGGGTTATGG - Intergenic
1067716837 10:48696611-48696633 GAAGGCAAAAGGAAGGGTCTAGG + Intronic
1068583608 10:58771490-58771512 TAAGGGAACAAGCAGTGTCACGG + Intronic
1069364434 10:67682381-67682403 TTATGTAAAAAGAAGGGCAATGG + Intronic
1070575488 10:77674125-77674147 TATTGTAAAGAGAAGGGCCAGGG + Intergenic
1072211786 10:93253000-93253022 TAAGATAGAAGGAAGAGTCAGGG - Intergenic
1073614275 10:104977133-104977155 TGAGGTAAAAATAGGGGGCAAGG - Intronic
1074092237 10:110271977-110271999 AGAGGGAAAAAGAAGGGACAGGG - Intronic
1074255956 10:111802874-111802896 TAAGATAAAAAGAATGGCAAAGG + Intergenic
1074991272 10:118710529-118710551 TTAGGTAGAAAGAACAGTCAGGG - Intronic
1075794147 10:125106928-125106950 TAAAGCAAAAAGAAGGGGAATGG + Intronic
1076434983 10:130434527-130434549 AGAGGTGAAAAGAAGGGACAAGG + Intergenic
1076659657 10:132047188-132047210 TAAGGTAAAAAGGCGGGGCAGGG + Intergenic
1077362183 11:2145634-2145656 TAAGGTAGGAAGAAGGCTGAGGG + Intronic
1080436858 11:32252995-32253017 TGAGATAAAAGGAAGGTTCATGG - Intergenic
1080851118 11:36071033-36071055 AATGATAAAAAGAAGAGTCATGG + Intronic
1081031670 11:38091993-38092015 TAAGGGAAAAAGAATTGTCATGG - Intergenic
1081816059 11:45942997-45943019 TATGAGAAAAAGAATGGTCAAGG - Intronic
1084984643 11:72857868-72857890 TGAGGTAGAAAGCAGGGTCTTGG + Intronic
1086171759 11:83844237-83844259 TAGGGTAAAAAAAAGGGCCTGGG + Intronic
1086497488 11:87419572-87419594 AAAGTTGAAAAGATGGGTCAGGG + Intergenic
1086921591 11:92594002-92594024 GATGGGAAAAAGGAGGGTCAGGG - Intronic
1087179874 11:95131308-95131330 GAAGGTAAATGGAAGGGTGAGGG + Exonic
1087617089 11:100499310-100499332 GAAGGTATAAAGAAGAGTGAGGG + Intergenic
1088519550 11:110680247-110680269 TCTGGTAAGAAGAAGGGCCAGGG + Intronic
1088548012 11:110981215-110981237 TAAGGTAAAAATAAAGTGCAAGG + Intergenic
1090536414 11:127646416-127646438 GAGGGCAAAAAGGAGGGTCAGGG + Intergenic
1090693078 11:129206197-129206219 TTAATTAAAAAGAAGGTTCAAGG - Intronic
1090951874 11:131480825-131480847 TAAAGTGAAAAGAAGCTTCAGGG - Intronic
1091009149 11:131982445-131982467 TGAGGAAACAAGGAGGGTCATGG + Intronic
1091013863 11:132031531-132031553 TGAGATAAAGAGATGGGTCAAGG + Intronic
1091068661 11:132542422-132542444 TAAACTTAGAAGAAGGGTCATGG - Intronic
1091215077 11:133896089-133896111 TAAGGCAAAAAAAAGGAGCAGGG - Intergenic
1092549629 12:9484139-9484161 TTAGGTAAGAAGAAAGGGCAGGG + Intergenic
1092619703 12:10250819-10250841 TAAGGTAATATAAAGGGTCTTGG + Intergenic
1092844572 12:12572139-12572161 TAAGGGGAAAAGCAGTGTCAAGG + Intergenic
1093098333 12:14997513-14997535 AAAGTTAGAAAGAAGGGTTAGGG - Intergenic
1093604624 12:21074649-21074671 AAAGGTAAAAAGAAGTGCAAAGG + Intronic
1093643903 12:21560284-21560306 TAAGGAAAAAACAAAGTTCAAGG + Intronic
1093794133 12:23291079-23291101 TAAGGTCAACAGAAGATTCAGGG - Intergenic
1094130209 12:27066810-27066832 TAAGGTAATAAGTAGTGTCAGGG - Intergenic
1094179672 12:27578822-27578844 TAAGGTAATAAGTAGTGTCAGGG - Intronic
1095149117 12:38770293-38770315 TCAGGAAAATAGAAGAGTCAAGG - Intronic
1095857965 12:46882047-46882069 GAAGGTAAAGACAAGGGCCAGGG - Intergenic
1097561910 12:61217977-61217999 TAAGGAAGAAGGAAGAGTCAAGG - Intergenic
1097712271 12:62930012-62930034 GAAGGGAAAAAGAAAGGCCAGGG + Intronic
1097728290 12:63099348-63099370 GAAGGAAAACAGAAGGGGCAAGG + Intergenic
1098695067 12:73542145-73542167 TAAGGTATAAAGAAGGGGTCAGG - Intergenic
1099026113 12:77466516-77466538 TAAGGTAGAAAGGAGCCTCAGGG - Intergenic
1100085554 12:90905880-90905902 TAAGGAAAAAAGATTAGTCATGG + Intronic
1100828663 12:98498061-98498083 TGAGTTAAAAAGAGGAGTCAAGG - Intronic
1101101722 12:101400442-101400464 TAAAGAATAAAGAAGGGTAAAGG + Intronic
1102718413 12:114995126-114995148 TAAGTTAAAAAGAAGGGGGAAGG - Intergenic
1103018794 12:117517040-117517062 TGAGGAAAAAGGAAGGGGCATGG - Intronic
1104121638 12:125805501-125805523 GAAGATAAAAAGAGGAGTCAAGG + Intergenic
1104159172 12:126162022-126162044 GAAGGTAAAAACAAGGAACAGGG - Intergenic
1104792189 12:131490402-131490424 TAATTTAGAAAGAATGGTCAAGG - Intergenic
1105788844 13:23777065-23777087 TAAAGTAAAAAGAGAAGTCAAGG + Intronic
1106053785 13:26219253-26219275 TAAGGTGAAAATAGGGGACATGG - Intronic
1106485830 13:30171714-30171736 GAAGGTAACGAGAAGGGGCAGGG + Intergenic
1106623413 13:31393771-31393793 TAAAATAAAAAAAAGGTTCATGG - Intergenic
1107700688 13:43044536-43044558 AAAGGAAAAGAGAAGAGTCAAGG - Intronic
1109036962 13:57275806-57275828 TAATTTAAAAAGAAGGGAAAGGG - Intergenic
1109047240 13:57428641-57428663 TAAGGTGTAAGGAAGGGTCCAGG - Intergenic
1109966445 13:69704275-69704297 TAAGGTAAAAAGAAGGGTCAAGG - Intronic
1110386543 13:74918627-74918649 TAAGATTAAAATAAGTGTCAGGG + Intergenic
1110476807 13:75925315-75925337 TAATGTATAAAGATTGGTCATGG + Intergenic
1110523023 13:76503347-76503369 TAAGGCACAAAGAAGGGAGATGG + Intergenic
1111551915 13:89824283-89824305 TAAGGGAAGAAGAAGGTGCATGG - Intergenic
1112154527 13:96803016-96803038 TAAAGTAAAATGAAGAGTCAGGG - Intronic
1112415961 13:99203620-99203642 TAAAGTAATAAGCAGGATCAAGG + Intronic
1113207445 13:107933461-107933483 TAAGGTAAATAGTAGGGTGCAGG + Intergenic
1114774622 14:25467020-25467042 TAAGAGAAAAAGCAGGATCAAGG + Intergenic
1114943545 14:27648891-27648913 TAAGGTGTAAGGAAGGGTCCAGG + Intergenic
1116172676 14:41423003-41423025 TAAGCTACTAAGAAGTGTCAAGG - Intergenic
1117247585 14:53901205-53901227 TGAAGTAAACAGAAGAGTCATGG - Intergenic
1117928763 14:60814678-60814700 TAAAGGAAAAATAAGGGTAAGGG + Intronic
1118076871 14:62309042-62309064 TTAATTATAAAGAAGGGTCATGG + Intergenic
1118169539 14:63373688-63373710 TAAGGTACAAAAAAGGATCCTGG + Exonic
1120106855 14:80506152-80506174 GAAGGTAAGGAGAAGGATCAGGG + Intronic
1120248703 14:82036029-82036051 TAAGGCAAAAAGAAGGGGTGTGG - Intergenic
1120380455 14:83771973-83771995 TAAGGTAAATATAATGATCAGGG - Intergenic
1120838834 14:89064975-89064997 TTAGGGACAAAGCAGGGTCAAGG + Intergenic
1121368448 14:93335851-93335873 TAAGATAAAAAGAGGTGTTAGGG - Intronic
1123680057 15:22756733-22756755 TAAGACAAAAAGATGGGTCACGG + Intergenic
1124332269 15:28831186-28831208 TAAGACAAAAAGATGGGTCACGG + Intergenic
1125786546 15:42323390-42323412 TAAGGGCCAAAGAAAGGTCAGGG + Intronic
1127439993 15:58997135-58997157 TAAGGTACAAAGAATGTACAGGG + Intronic
1129340678 15:74884085-74884107 AAAGGTAAAATGCAGGGACAAGG + Intergenic
1130790739 15:87153276-87153298 TAAAGTAAAAAGAAAGATCGAGG - Intergenic
1131275096 15:90974117-90974139 TAAGGTAAACACAAGGCTTAGGG - Exonic
1131524067 15:93138788-93138810 TAAGGGGCAAAGCAGGGTCAGGG + Intergenic
1131782087 15:95870787-95870809 TAAGATAGAAGGAAGTGTCATGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132513866 16:357046-357068 TGATGGAAAAAGAAGGCTCAGGG - Intergenic
1133150017 16:3821023-3821045 TAAGCAAAAACGACGGGTCAAGG + Intronic
1133312417 16:4858230-4858252 TAAGGTACAGAAAAGGGGCATGG + Intronic
1133612989 16:7450662-7450684 TAAAGTGAAAAGAAGGGTGTTGG + Intronic
1135186830 16:20322770-20322792 TAAGGTATAAAGCAGAGTCAGGG - Intronic
1135708712 16:24696862-24696884 CAAGGCAAAAAGAAGGGGAATGG - Intergenic
1138344751 16:56313122-56313144 TAAGGTAAAAAGATGTGTCTAGG + Intronic
1139194212 16:64899430-64899452 CAAAGAAAAGAGAAGGGTCAGGG + Intergenic
1139679577 16:68550876-68550898 AAAGGAAAAATGAAGAGTCAAGG + Intronic
1139988902 16:70923170-70923192 TAAAGTAGAAAGAAGGGGCCAGG + Intronic
1140766935 16:78168586-78168608 CATGGTAAAAAGATGGGCCATGG - Intronic
1141200508 16:81894126-81894148 AAATGTGAAAAGAATGGTCAGGG + Intronic
1141490550 16:84369394-84369416 GAAGCTAAAAAGAAGGGTGTTGG - Intronic
1142497129 17:311951-311973 TAAGGTAAAATGAGGGTGCAAGG + Intronic
1143372787 17:6450644-6450666 TGAGGCAAATAGAAGGCTCAAGG - Exonic
1144513153 17:15894816-15894838 TAAAGTCCAAAGAATGGTCATGG + Intergenic
1147055375 17:37830221-37830243 TAAATTAAAAAGAATGGTCAAGG + Intergenic
1147988461 17:44319649-44319671 TAAGGAATTAACAAGGGTCAGGG + Exonic
1148846273 17:50532017-50532039 TAAGGCAGAAAGATGGCTCAAGG - Intergenic
1149013674 17:51884034-51884056 CAAAGAAAAAAGAAGGGTCAAGG - Intronic
1149702933 17:58670452-58670474 GAAGGTAAGAATAAGGATCAGGG + Intronic
1151055689 17:71028342-71028364 TGAGGTAAAAAGGAGGGTAAAGG + Intergenic
1151214237 17:72566639-72566661 GAAGGGAAAAAGAAGTTTCATGG + Intergenic
1154387199 18:13904862-13904884 TAAGGTATAAGGAAGGGGCCCGG - Intronic
1154928932 18:20972224-20972246 TAAGAAAAAAAGAAGAGTCTAGG + Intronic
1155799616 18:30084306-30084328 TTAGGTAAAAAGAAGGGAGTGGG - Intergenic
1156160913 18:34357009-34357031 CAAGGAAAAAAAAAGGGACAAGG + Intergenic
1158053579 18:53253803-53253825 TAAGGTAAATAAAAATGTCATGG - Intronic
1158333866 18:56393710-56393732 TAAGGTAATAAGATGGGCCCTGG + Intergenic
1158783319 18:60678226-60678248 GAAGGGAAAAGGAAGGGTCTAGG + Intergenic
1158894892 18:61903529-61903551 TAAGGTGTAAGGAAGGGACATGG + Intergenic
1159047570 18:63383885-63383907 TAATGTAAAAAGAAGGGTCTAGG - Intergenic
1160898722 19:1415990-1416012 TAGGGAAAAAAGAAGGAACAGGG + Intronic
1162536622 19:11266274-11266296 TAAGGGACAAAGAAGGGTGCAGG - Intergenic
1164856324 19:31527460-31527482 GAAGGGAAACAGAAGGGTGAGGG + Intergenic
1166052761 19:40270187-40270209 TAGGGGAAAATGAAGGGTAAGGG - Intronic
1167161795 19:47772700-47772722 TAAGGCAAAAAGCAGATTCATGG + Intergenic
1168087041 19:54055819-54055841 GGAGGTAAAGAGAAGGGCCAGGG + Intronic
925237618 2:2293317-2293339 TAAGGAAAAAGGAAGAGTGAGGG + Intronic
925567661 2:5273586-5273608 TCAGGTACAAAGAAGAGTCAAGG + Intergenic
927395766 2:22649747-22649769 TAATGTAAAAAGAACTCTCAAGG + Intergenic
927433775 2:23049469-23049491 TAAGAGAAAGAGAAGTGTCAAGG - Intergenic
929175209 2:38968939-38968961 TAAGGTAGAGAGGAAGGTCAGGG + Intronic
929226024 2:39512443-39512465 GAAGGAAAAAAGAAAGGTCAAGG - Intergenic
931010438 2:57906274-57906296 TAAGATAAAAAGTAGTGTCTGGG + Intergenic
931163015 2:59715152-59715174 TAAGAGAAAGAGAGGGGTCACGG - Intergenic
931944445 2:67289440-67289462 TAAGCTAAAATGAAATGTCAAGG - Intergenic
932198969 2:69809196-69809218 ATAAGTAAAAAGAAGGGGCAAGG - Intronic
932531537 2:72539196-72539218 AAAGGAAAAAAGAAGGGGGAGGG + Intronic
933538309 2:83605665-83605687 TCAGGTAAAAAGAAATGACATGG + Intergenic
933600566 2:84325565-84325587 ACAGGTAAAGAGAAGGGCCAGGG + Intergenic
933742844 2:85548265-85548287 CAAGGAAAAAGGAAGAGTCAAGG + Exonic
933972491 2:87481471-87481493 AAAGGTAAATACAAGGTTCAGGG + Intergenic
936321240 2:111468703-111468725 AAAGGTAAATACAAGGTTCAGGG - Intergenic
936404653 2:112192030-112192052 TAAGCAAAATAGAAGGGTCCAGG - Intergenic
936620033 2:114086268-114086290 TAATGTATAATGAAGTGTCACGG + Intergenic
936893787 2:117403846-117403868 TAAGGAAAAGCAAAGGGTCATGG + Intergenic
936947414 2:117942994-117943016 TGAGATAAAAAGAGGAGTCAAGG - Intronic
937188743 2:120071741-120071763 TAAGGTGTAAGGAAGGGTCCAGG - Intronic
937606296 2:123805520-123805542 TAAATTAAAAAGAAAGTTCAAGG + Intergenic
937765082 2:125651836-125651858 AAAGGAAGAAAGAAGAGTCAGGG - Intergenic
937889672 2:126927970-126927992 TAAGCTAAAAAGAAATTTCAAGG - Intergenic
938277545 2:130039652-130039674 TAAGGTAAAGAGACGGCTTAGGG - Intergenic
938328511 2:130430455-130430477 TAAGGTAAAGAGACGGCTTAGGG - Intergenic
938361435 2:130691039-130691061 TAAGGTAAAGAGACGGCTTAGGG + Intergenic
938437841 2:131297728-131297750 TAAGGTAAAGAGACGGCTTAGGG + Intronic
939008639 2:136819436-136819458 TGAGGGAAAAAGAAGGGGGAGGG - Intronic
940656551 2:156494070-156494092 AAAGGTAAAAAATAGGGACATGG + Intronic
941740201 2:169027903-169027925 TGAAGAAAAAAAAAGGGTCAGGG + Intronic
941855129 2:170223180-170223202 TCAGGTAAAGAGAAGGTTCAAGG - Intronic
942876204 2:180801846-180801868 TAAGAAAAAAGGAAGGATCAGGG + Intergenic
943118524 2:183705326-183705348 GAAGGGTAAAAGAAGGGTGAGGG + Intergenic
945220173 2:207475533-207475555 TTAGGTAAAAACATGGTTCATGG + Intergenic
945344285 2:208694291-208694313 TAAGATAAAAACAAAGGCCATGG - Intronic
946590667 2:221243807-221243829 GAAGGTAAAAAGAAAAGTAAGGG - Intergenic
947016486 2:225626196-225626218 AAAGATAAAAAGAATGGTCCAGG + Intronic
947125055 2:226860080-226860102 TAAGGTCAAAAGACATGTCAAGG + Intronic
947458844 2:230284342-230284364 GAAGGAAAAAAGAGGGGGCATGG + Exonic
947469082 2:230383506-230383528 GAAGGAAAAAAGAAGGGGCATGG + Exonic
1169145591 20:3250168-3250190 TAAGGTCAAAAGCAGTGTCATGG + Exonic
1169582541 20:7040381-7040403 AAATGTAAAAAGAAGGTTAAAGG - Intergenic
1170316315 20:15044612-15044634 TAAGGTAAAGAGGAGAGTAAAGG + Intronic
1170623450 20:18012574-18012596 TAAGGAAAAAAGCAGGGCCTTGG - Intronic
1172178233 20:32985415-32985437 TAAGGTCCAGAGAAGGATCAGGG - Intronic
1173002161 20:39112143-39112165 TGAGGTCTAAAGAAGGGTCCTGG + Intergenic
1173700871 20:45070446-45070468 TGAGGGAAAAGGAAGGATCAGGG + Intronic
1175744719 20:61447851-61447873 GAAGGTAAAAAAGAGGGTTATGG - Intronic
1177986821 21:27986496-27986518 GAAGGAAAAAAGAAGGGAGAGGG + Intergenic
1179573104 21:42289700-42289722 AAAGGTAAAAACAATGGTGAGGG - Intronic
1181180568 22:21065251-21065273 GAAGGTAAATAGAAGGGAGAAGG - Intergenic
1181284225 22:21740459-21740481 TGAGGGAAAGAGAGGGGTCAAGG - Intergenic
1182563310 22:31179086-31179108 TCAGGAGAAAAGAATGGTCAGGG + Intronic
1182841963 22:33398336-33398358 GAAGTTAAAAAAAAAGGTCAAGG + Intronic
1184226195 22:43130075-43130097 AAAGGTACAAAGCAGGGTCCTGG - Intergenic
949147230 3:716900-716922 TAAGGTAAATAGAATGAGCAGGG + Intergenic
952040459 3:29255580-29255602 TCAGGTAAAAACAAGGGGCCTGG + Intergenic
952173459 3:30835379-30835401 TCATGTAAAAAGAAGTGGCATGG + Intronic
952287637 3:31983492-31983514 TAAGCTAAAAGGAATAGTCAAGG + Intronic
952361596 3:32635732-32635754 TAAGAGAAAAAGAAGAGTCATGG - Intergenic
953107352 3:39896753-39896775 TAAAGTACCTAGAAGGGTCAAGG - Intronic
953493693 3:43369374-43369396 AAAGGTAGAAAGAATGGCCAGGG + Intronic
954463310 3:50639975-50639997 TATGGTAAAAATGAGGCTCAAGG + Intronic
956223749 3:66933344-66933366 CAAGGTAAGCAGAAGGGACAAGG - Intergenic
956608586 3:71098842-71098864 TTAGGCACAAATAAGGGTCATGG - Intronic
961126209 3:124420448-124420470 GAAAGTAAAGATAAGGGTCAGGG + Intronic
964022204 3:152026098-152026120 TATGTTTAAAAGATGGGTCAGGG + Intergenic
964042848 3:152283916-152283938 TAAGTTAAAGAGAGAGGTCAAGG - Intronic
964541821 3:157787891-157787913 TGAGGGAAAGAGAAGAGTCAAGG - Intergenic
964684173 3:159376691-159376713 AGAGGTAAAAAGAAGGGAGAAGG - Intronic
965331705 3:167382598-167382620 TAAGCTTGAAATAAGGGTCAGGG + Intergenic
966417042 3:179700133-179700155 AAAGGTTAAACGAAGGCTCAGGG - Intronic
966817132 3:183898511-183898533 TAAGTTAAAAAGAGGGGGCCAGG - Intergenic
967278654 3:187801305-187801327 TATGGCACAAAGAAGGCTCATGG - Intergenic
967952234 3:194850325-194850347 AAAGGAAAAAATAAGGGTAAGGG + Intergenic
970466978 4:16333996-16334018 TTAGGTAAAATGATGGGTCTTGG - Intergenic
970910665 4:21271090-21271112 TAGGGTAAAGAGAAGGATCTTGG + Intronic
972282361 4:37614973-37614995 TAAGCTAAAAAGGAGGGGCCTGG + Intronic
973221385 4:47731088-47731110 AAAGAGAAAAAGAAGAGTCAAGG + Intronic
975032196 4:69634867-69634889 TAAGATAAAAATGAGGGTAATGG - Intronic
975405163 4:73980849-73980871 AAAGGTAATAATAATGGTCAAGG + Intergenic
975662241 4:76699363-76699385 AAAGGTAAAAAGCAGGGGGAGGG - Intronic
976016811 4:80565354-80565376 TAAGTAAAAAAGCAAGGTCAAGG + Intronic
976172766 4:82321360-82321382 AAAGGTAAAAAGAAGAGAAAGGG + Intergenic
976831208 4:89316838-89316860 AAAGAAAAAAAGCAGGGTCAGGG + Intergenic
977525123 4:98135677-98135699 AAAGGTAAAAGGAAGGGAAAGGG + Intronic
977743352 4:100514393-100514415 TAAAATGAAAAGAAGGGTCTAGG - Intronic
977895567 4:102361046-102361068 TAAGGTAAAATGAAGTCACATGG + Intronic
978118028 4:105045597-105045619 TAAGGCATAAAATAGGGTCATGG - Intergenic
978873495 4:113608776-113608798 TAAAGTAAAAAGAAGACTCAAGG - Intronic
979977477 4:127214461-127214483 TAGGGAAAAAAGGAGGGGCATGG + Intergenic
980223728 4:129954032-129954054 TAAGGAAAAGAGAAGAGTCAAGG - Intergenic
980332683 4:131429863-131429885 TAAAGTAAAGAGAAGGGGTAGGG - Intergenic
981423933 4:144582027-144582049 AAAAGGAAAAAAAAGGGTCAAGG + Intergenic
982263873 4:153520687-153520709 TAAGGAAAGAAGAAGAGACAGGG - Intronic
983014609 4:162597241-162597263 TAAGACAAAAATAAAGGTCATGG + Intergenic
983090668 4:163497984-163498006 TTATGTAAAAAGAAAGGTTAGGG - Intronic
985430568 4:189875717-189875739 CAAGAAACAAAGAAGGGTCAGGG + Intergenic
986905222 5:12487654-12487676 TAAGGTGAAAAGTACTGTCAAGG - Intergenic
988406757 5:30833893-30833915 TAAGGTATAAAGAAGGGATCTGG - Intergenic
989081673 5:37629375-37629397 GATGGAAAAAAGAAGGGTAAAGG - Intronic
991179704 5:63735655-63735677 TAAGGTAAATAGAAGATGCATGG - Intergenic
992415632 5:76550214-76550236 GAAGGAAGAAAAAAGGGTCATGG + Intronic
992744852 5:79809394-79809416 TAAAGAAAAAAGAAGAGCCAGGG - Intergenic
993214034 5:84996341-84996363 TAAAGTCAAAAGAATAGTCAAGG - Intergenic
993564515 5:89456692-89456714 TAAGGTAAAAATAAAGCCCAGGG + Intergenic
994216851 5:97147325-97147347 AATGGTAAGAAGAAGGCTCAGGG + Intronic
994324380 5:98432404-98432426 AAAGGTCAAAAGAAGGGGAAAGG + Intergenic
994606691 5:101976267-101976289 CAAGGTAAAGAGAAGGATAATGG + Intergenic
994734561 5:103536393-103536415 CAGGTTAAAGAGAAGGGTCAAGG - Intergenic
995120264 5:108529011-108529033 CAAGATAAAAAGAAGGGGAAAGG + Intergenic
996369834 5:122741475-122741497 TAAGGTAAAGAGAAGAATGAAGG - Intergenic
997152853 5:131517688-131517710 TAAGGTGAAAGGAAAGATCAAGG + Intronic
997707591 5:135972684-135972706 TAATATAAAAATAATGGTCATGG - Intergenic
998959097 5:147465859-147465881 GAAGAGAAAAAGAAGGATCAGGG - Intronic
999003546 5:147950211-147950233 GAAGGAAAAAAGAAGGGAGAGGG - Intergenic
999650545 5:153763188-153763210 CAAGGTAAAGTGAAGTGTCAAGG + Intronic
999970929 5:156861895-156861917 AAAAGTAAAAAGATGGGTGAAGG + Intergenic
1000146596 5:158459422-158459444 TAAGGTAAAAAGAACCATGAAGG - Intergenic
1000443274 5:161287716-161287738 TGAGGTAGAAAGAAGTTTCAAGG + Intergenic
1000849828 5:166326124-166326146 AAAGAAAAAAAGGAGGGTCAGGG + Intergenic
1000907758 5:166983422-166983444 TCAGGTGAAAAGAATGATCAGGG + Intergenic
1002543361 5:179921264-179921286 TAGGGTAGAAAGAAGGGCAAGGG - Intronic
1003608727 6:7589598-7589620 TAATTTAAAAAGGAGGGTGAAGG + Intergenic
1005242070 6:23842004-23842026 TAAGAAAAAAAAAAGGATCAAGG + Intergenic
1007179909 6:39922591-39922613 TCAGCTGAAAAGAAGGGGCATGG + Intronic
1007459672 6:42009048-42009070 TAAGGTATACAGAAGTGTAAGGG + Intronic
1007927025 6:45658055-45658077 TGAGGGAAAGAGAAGGGTCAAGG + Intronic
1008469231 6:51864525-51864547 TAAGGTACAAAGATGAGTCAAGG + Intronic
1008776193 6:55040925-55040947 TAAGAGAAAAAGAAGAGTCAGGG + Intergenic
1008951499 6:57164819-57164841 TAAGGCAGAAAGAATGGTAAGGG + Intronic
1009593400 6:65704001-65704023 GAAGGTGAAAAGAAGAGCCATGG + Intronic
1010984139 6:82402918-82402940 TCAGGAAAAAAGAAGGCACATGG - Intergenic
1011269682 6:85564687-85564709 TAAAGTAAAAATAAGGTTTAAGG + Intronic
1012193684 6:96313040-96313062 AAAGGTAAAGGGAAGGGGCAGGG + Intergenic
1012277404 6:97291089-97291111 TTATGTACAAAGAAGGGTAAGGG - Intergenic
1012779581 6:103540578-103540600 TAAGGTAAAATGAAGTCTTATGG + Intergenic
1013056421 6:106587660-106587682 AAAGGTAGGAAGAAGGGTCTTGG - Exonic
1013444813 6:110213787-110213809 AAAGGTGAAAAGAAGGGGCTGGG - Intronic
1013994669 6:116294529-116294551 CCAGGTTAATAGAAGGGTCAGGG + Intronic
1014097697 6:117478640-117478662 CTAGATAAAAAGAAGGCTCAGGG - Intronic
1014344284 6:120248188-120248210 TAAAATAAAAAGAAAGGTAAAGG + Intergenic
1014768804 6:125437791-125437813 ATAGAGAAAAAGAAGGGTCATGG - Intergenic
1015188191 6:130442859-130442881 GAAGGTAAAAAGAAATGTCAAGG - Exonic
1015778217 6:136836370-136836392 TAAGGTAGAAAGCAGGGGAAGGG + Intronic
1016224104 6:141712963-141712985 TAAGGGTAAAAGAAGGGATATGG + Intergenic
1016336780 6:143014514-143014536 GCAGGTCAAAAGAAGAGTCAAGG + Intergenic
1016892345 6:149019238-149019260 TAAGGGCTAAAGCAGGGTCATGG + Intronic
1017002962 6:150008596-150008618 GAAGGAGAAAAGAAGGGTTAGGG + Intergenic
1017268674 6:152480731-152480753 AAAGGTAAAAAGCAGCGACAGGG - Intronic
1018463972 6:164025610-164025632 TAAGGTACAGAGAAAGGACATGG - Intergenic
1018623718 6:165756942-165756964 TAATGGAAAAAGCGGGGTCAGGG - Intronic
1020433990 7:8142564-8142586 TATGGTGAAAAGAAGGTGCAGGG + Intronic
1020603195 7:10302706-10302728 GAAGGTAATAAGTAGGGTCCTGG - Intergenic
1021090524 7:16477552-16477574 GAAGGGGAAAATAAGGGTCAGGG + Intronic
1023355503 7:39363254-39363276 TAAGGAAAACAGAGGAGTCAAGG + Intronic
1023954674 7:44874853-44874875 TAAGGTATAAAGAAGGGAAAAGG - Intergenic
1024334378 7:48191219-48191241 TAAACTATAAAGAAAGGTCAAGG - Intronic
1025637156 7:63332569-63332591 TAAAGTAAAAAAAAGGGGCTGGG + Intergenic
1025645539 7:63415533-63415555 TAAAGTAAAAAAAAGGGGCTGGG - Intergenic
1026065402 7:67067405-67067427 TAAGTAAAAATGAAAGGTCATGG + Intronic
1026711475 7:72744460-72744482 TAAGTAAAAATGAAAGGTCATGG - Intronic
1027503437 7:78984422-78984444 TAATGTTAAAGGAAGGGTGAGGG - Intronic
1029656996 7:101932820-101932842 TAAAGTAAAAAACAGGATCAGGG + Intronic
1030507252 7:110440644-110440666 TAAAGAAAAAAGAAAGATCAGGG + Intergenic
1030745257 7:113158044-113158066 AAAGGTAAAAAGAAATGTGAAGG - Intergenic
1031710525 7:125040445-125040467 TAAAGTTAAAAGAAGTGGCAGGG + Intergenic
1032345658 7:131114079-131114101 TAAGGTAGCAAGAATGGACATGG + Intronic
1033009479 7:137604888-137604910 TAAGGCAAACAGAAGTGTAAGGG + Intronic
1033265095 7:139878449-139878471 AAAGGAAAAAAGAAAGGTGATGG + Intronic
1037117612 8:15245594-15245616 AAAGGCAAAATGAAGGATCATGG + Intergenic
1038649727 8:29391413-29391435 TAAGGGGAAAAGAAGGCTTACGG - Intergenic
1038947582 8:32378167-32378189 TAAGGGAGAAAGAAGGAACAAGG + Intronic
1039216934 8:35282402-35282424 AAGGGTATTAAGAAGGGTCATGG - Intronic
1042182569 8:66106218-66106240 TAAGGCAAAAGGAAGGGGAAGGG - Intergenic
1042863918 8:73340235-73340257 AAAGATAAAAAGAAGGGAAAAGG + Intergenic
1043108453 8:76146953-76146975 TAAGGAAAACAGTAGAGTCAGGG + Intergenic
1043977403 8:86598868-86598890 TAACTTGAAAAAAAGGGTCAGGG - Intronic
1044958058 8:97502444-97502466 TAAGAAGAAAAGAAGAGTCAAGG + Intergenic
1045693954 8:104787067-104787089 TAAGGGTAAAAGAATGGTTACGG + Intronic
1045935241 8:107671340-107671362 TAAGGAAAAAAGGAGGGTCCAGG + Intergenic
1046349450 8:112987987-112988009 TAAGGAAAATAGAAGGGTCTAGG + Intronic
1051046376 9:12879965-12879987 AAAGGTAAAATGAAAGGGCAAGG - Intergenic
1052658555 9:31398284-31398306 TAAGGTAGAAAGAAGAATGATGG - Intergenic
1052986417 9:34491263-34491285 TAAGCTAGAAAGCAGGGGCAGGG - Intronic
1053231302 9:36412314-36412336 TCAGGTGAAAATCAGGGTCATGG - Intronic
1058009510 9:99960894-99960916 TAAGGTAGAAAGAAGCATTAAGG + Intronic
1058373090 9:104292922-104292944 TATGGGACAGAGAAGGGTCAAGG - Intergenic
1059454406 9:114390418-114390440 TAAGGGAAAAGGAAGTGTCCAGG - Intronic
1059771423 9:117430159-117430181 TAAGTTAAAAAGAAGTGTGTGGG + Intergenic
1060025066 9:120163839-120163861 TAAGGTAAAAAAAAGAGAGATGG - Intergenic
1060773818 9:126353655-126353677 TAAGGGAAAAAGAAAAGTCAAGG - Intronic
1060873986 9:127066779-127066801 TATGGGAAAAGGAAGTGTCAAGG - Intronic
1061203338 9:129149487-129149509 TAAGGCCAAGAGAAAGGTCAAGG - Intergenic
1061301924 9:129710371-129710393 TAAGGCACAAAGGAGGGTCTTGG - Intronic
1185721811 X:2388360-2388382 TAAGGTAAAATGAGGTTTCAGGG + Intronic
1186844502 X:13517350-13517372 AGAGAGAAAAAGAAGGGTCACGG - Intergenic
1187658507 X:21510352-21510374 AAAGGTAAAAAAAAAGGTCTGGG + Intronic
1188372987 X:29391675-29391697 TAAAGTAAAACCAAGGGTTAAGG + Intronic
1189174745 X:38944795-38944817 TAAGGGAAAAAGAAGAGTCTTGG - Intergenic
1190426628 X:50339463-50339485 TAAGCTAAAGAGAAAAGTCAAGG - Intronic
1192459505 X:71304841-71304863 TAAGGTAAGAAAAAAGGTAAGGG - Intronic
1192930094 X:75797896-75797918 TAAGGAAAAAAGAAATGTTAAGG - Intergenic
1193251068 X:79291014-79291036 TAAGCTAACAAGGAGGGTGAAGG - Intergenic
1194152963 X:90348812-90348834 TAAAGAAAAAAAAAGGGGCAAGG + Intergenic
1194403152 X:93462275-93462297 AAAGGAAAAAAAAAGGGTCGGGG + Intergenic
1194867172 X:99084015-99084037 TAAGGAAAAAAGGAAGGACATGG - Intergenic
1195869995 X:109475663-109475685 TCAGGTCAAAAGATGGGTCCCGG + Exonic
1196240282 X:113336098-113336120 TAAGTTAAAAATAGGGGTGAAGG + Intergenic
1197107899 X:122737619-122737641 AAAGGGAAAAAGGAGGATCAAGG + Intergenic
1197881859 X:131175211-131175233 TGAGAGAAAAAGAAGAGTCAAGG + Intergenic
1198220613 X:134597922-134597944 TGAGGCAAAAAGAAAGCTCAGGG + Intronic
1198438578 X:136640114-136640136 TAAGTCAAGAAGAAGGATCATGG + Intergenic
1199919556 X:152383813-152383835 TAAGCTGAAAAGAAGTGGCAAGG - Intronic