ID: 1109968969

View in Genome Browser
Species Human (GRCh38)
Location 13:69739528-69739550
Sequence CAGACAAAATAAAAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4262
Summary {0: 1, 1: 0, 2: 7, 3: 159, 4: 4095}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109968966_1109968969 2 Left 1109968966 13:69739503-69739525 CCTATCTCACATGCAAAGACATA 0: 36
1: 627
2: 2410
3: 4935
4: 3535
Right 1109968969 13:69739528-69739550 CAGACAAAATAAAAGGATGGAGG 0: 1
1: 0
2: 7
3: 159
4: 4095

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109968969 Original CRISPR CAGACAAAATAAAAGGATGG AGG Intronic
Too many off-targets to display for this crispr