ID: 1109977690

View in Genome Browser
Species Human (GRCh38)
Location 13:69861660-69861682
Sequence TAAAAGCAAGCCTGGCGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2318
Summary {0: 1, 1: 0, 2: 11, 3: 239, 4: 2067}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109977684_1109977690 16 Left 1109977684 13:69861621-69861643 CCACCTAACCTCTTATCCTGTCC 0: 1
1: 0
2: 1
3: 11
4: 222
Right 1109977690 13:69861660-69861682 TAAAAGCAAGCCTGGCGCAGTGG 0: 1
1: 0
2: 11
3: 239
4: 2067
1109977683_1109977690 17 Left 1109977683 13:69861620-69861642 CCCACCTAACCTCTTATCCTGTC 0: 1
1: 0
2: 1
3: 10
4: 165
Right 1109977690 13:69861660-69861682 TAAAAGCAAGCCTGGCGCAGTGG 0: 1
1: 0
2: 11
3: 239
4: 2067
1109977686_1109977690 8 Left 1109977686 13:69861629-69861651 CCTCTTATCCTGTCCTCAAAGAC 0: 1
1: 0
2: 1
3: 14
4: 208
Right 1109977690 13:69861660-69861682 TAAAAGCAAGCCTGGCGCAGTGG 0: 1
1: 0
2: 11
3: 239
4: 2067
1109977685_1109977690 13 Left 1109977685 13:69861624-69861646 CCTAACCTCTTATCCTGTCCTCA 0: 1
1: 0
2: 1
3: 19
4: 270
Right 1109977690 13:69861660-69861682 TAAAAGCAAGCCTGGCGCAGTGG 0: 1
1: 0
2: 11
3: 239
4: 2067
1109977687_1109977690 0 Left 1109977687 13:69861637-69861659 CCTGTCCTCAAAGACAAGAAAAA 0: 1
1: 0
2: 5
3: 65
4: 1026
Right 1109977690 13:69861660-69861682 TAAAAGCAAGCCTGGCGCAGTGG 0: 1
1: 0
2: 11
3: 239
4: 2067
1109977688_1109977690 -5 Left 1109977688 13:69861642-69861664 CCTCAAAGACAAGAAAAATAAAA 0: 1
1: 0
2: 27
3: 553
4: 10157
Right 1109977690 13:69861660-69861682 TAAAAGCAAGCCTGGCGCAGTGG 0: 1
1: 0
2: 11
3: 239
4: 2067

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109977690 Original CRISPR TAAAAGCAAGCCTGGCGCAG TGG Intronic
Too many off-targets to display for this crispr