ID: 1109979493

View in Genome Browser
Species Human (GRCh38)
Location 13:69888273-69888295
Sequence AGGTTTTAACATATGGAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1947
Summary {0: 1, 1: 1, 2: 52, 3: 333, 4: 1560}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109979482_1109979493 29 Left 1109979482 13:69888221-69888243 CCCAAATACCTCACAATGTCCTC 0: 1
1: 0
2: 1
3: 24
4: 405
Right 1109979493 13:69888273-69888295 AGGTTTTAACATATGGAATTTGG 0: 1
1: 1
2: 52
3: 333
4: 1560
1109979486_1109979493 7 Left 1109979486 13:69888243-69888265 CCAGCTTTTAATATAACCACAAT 0: 1
1: 0
2: 0
3: 27
4: 327
Right 1109979493 13:69888273-69888295 AGGTTTTAACATATGGAATTTGG 0: 1
1: 1
2: 52
3: 333
4: 1560
1109979491_1109979493 -9 Left 1109979491 13:69888259-69888281 CCACAATGGGGATTAGGTTTTAA 0: 2
1: 8
2: 64
3: 290
4: 600
Right 1109979493 13:69888273-69888295 AGGTTTTAACATATGGAATTTGG 0: 1
1: 1
2: 52
3: 333
4: 1560
1109979485_1109979493 10 Left 1109979485 13:69888240-69888262 CCTCCAGCTTTTAATATAACCAC 0: 1
1: 0
2: 3
3: 13
4: 170
Right 1109979493 13:69888273-69888295 AGGTTTTAACATATGGAATTTGG 0: 1
1: 1
2: 52
3: 333
4: 1560
1109979483_1109979493 28 Left 1109979483 13:69888222-69888244 CCAAATACCTCACAATGTCCTCC 0: 1
1: 0
2: 0
3: 15
4: 220
Right 1109979493 13:69888273-69888295 AGGTTTTAACATATGGAATTTGG 0: 1
1: 1
2: 52
3: 333
4: 1560
1109979484_1109979493 21 Left 1109979484 13:69888229-69888251 CCTCACAATGTCCTCCAGCTTTT 0: 1
1: 0
2: 2
3: 26
4: 259
Right 1109979493 13:69888273-69888295 AGGTTTTAACATATGGAATTTGG 0: 1
1: 1
2: 52
3: 333
4: 1560

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109979493 Original CRISPR AGGTTTTAACATATGGAATT TGG Intronic
900536106 1:3178625-3178647 AGGGTTTAACAGAGGGAACTAGG - Intronic
900733002 1:4275201-4275223 AGGCTTCAACACATGGACTTTGG - Intergenic
900825916 1:4926870-4926892 AGACTTCAACATATGGATTTTGG - Intergenic
900839595 1:5037509-5037531 GGGCTTTAACATATGAATTTTGG - Intergenic
901288983 1:8107316-8107338 AGGTTTCAACATAGGAATTTTGG - Intergenic
902038532 1:13475256-13475278 AGGTTTCAACATATAAAATCTGG + Exonic
902165479 1:14567979-14568001 AGGATTTCACATATGTGATTAGG + Intergenic
903150725 1:21406105-21406127 AGGTTCTAACATACGAATTTTGG + Intergenic
903544622 1:24116164-24116186 AAGTTTCAACATATGAATTTTGG + Intergenic
903558849 1:24212698-24212720 AGGTTTCAACATATAAATTTTGG - Intergenic
903561320 1:24230223-24230245 AAGATTTAACACATGGAATGAGG + Intergenic
904000034 1:27333691-27333713 AGATTTCAACATATGAACTTGGG + Intronic
904137331 1:28323553-28323575 AGGATTTAGCATATGAATTTTGG - Intergenic
904352828 1:29920134-29920156 AGGTTTCAACATAAGAATTTTGG - Intergenic
904691992 1:32300088-32300110 AGCTTTTAGCATATTGGATTTGG + Intronic
904862016 1:33545651-33545673 AGGTTTCAACATATGATTTTTGG + Intronic
905235982 1:36548583-36548605 AGGTTTCAACATATGAATTTTGG - Intergenic
905488560 1:38325581-38325603 GGATTTTAACATATGAATTTTGG + Intergenic
905514614 1:38553096-38553118 AGGTTTCAACATATGAATTTTGG + Intergenic
905530672 1:38676213-38676235 AGGTTTCAACATACAGATTTTGG + Intergenic
906228763 1:44142350-44142372 CAGTTTTAGCATATGAAATTTGG - Intergenic
906560276 1:46751513-46751535 AGGTTTCAACACATGAATTTGGG + Intergenic
906718608 1:47988919-47988941 AGGTTTCAACATACGAATTTTGG - Intronic
906773595 1:48508044-48508066 GGTTTTTAACATTTGAAATTAGG - Intergenic
907025119 1:51110197-51110219 AGTATTTAACTTATAGAATTTGG + Intronic
907287275 1:53389943-53389965 AGGTTCCAACATATGAATTTTGG + Intergenic
907446652 1:54512460-54512482 ACGTTTTAACATATGAATTTTGG + Intergenic
907506961 1:54926180-54926202 AGGCTTCAACACATGGATTTGGG - Intergenic
907646692 1:56251704-56251726 GGGTTTCAACATATGAATTTGGG - Intergenic
907753665 1:57288372-57288394 GGGCTTTAACATATAGATTTTGG - Intronic
907928377 1:58975730-58975752 AGGTTTTAACACATGGATTTTGG + Intergenic
907938175 1:59061360-59061382 AAGTTTTAACATATGAATTTTGG - Intergenic
907945375 1:59131300-59131322 GGATTTCAACATATGGATTTGGG - Intergenic
907948924 1:59162048-59162070 AGGTTTTAACATATGGATTTTGG + Intergenic
908021778 1:59905495-59905517 AGGTTTCAACATATAAATTTGGG + Intronic
908053896 1:60261986-60262008 AGGGTTCAACATATGAATTTAGG + Intergenic
908064770 1:60390924-60390946 GGGTTTTAACATATGAATTTTGG - Intergenic
908113106 1:60916383-60916405 AGGTTTCCACATATGAATTTTGG + Intronic
908261255 1:62340842-62340864 ACGTTTCAACATATGAATTTTGG + Intergenic
908265367 1:62373532-62373554 AAGTTCTAACATATGAATTTTGG + Intergenic
908267336 1:62392438-62392460 AGGTTTCAACGTATGAATTTTGG - Intergenic
908289323 1:62646401-62646423 GGGCTTTAACATATGAATTTTGG - Intronic
908379623 1:63583972-63583994 AGGTTTTAAGATATGGATCTTGG + Intronic
908714702 1:67056592-67056614 AAGTTTCAACATATGAATTTTGG + Intergenic
908735652 1:67273593-67273615 AGGCTTCAACATATGGATTTTGG + Intergenic
908810265 1:67975051-67975073 AGGTTTCAACATATGGATTTTGG + Intergenic
908959785 1:69682555-69682577 GGGTTTTAACATATACAGTTTGG - Intronic
908997364 1:70172003-70172025 AGATTTCAACATAGGAAATTTGG - Intronic
909025647 1:70478713-70478735 GGGCTTCAACATATGGATTTTGG + Intergenic
909029430 1:70522473-70522495 GGGTTTCAACATATAAAATTTGG + Intergenic
909079809 1:71096509-71096531 GGGTTTCAACATATGAATTTTGG - Intergenic
909097027 1:71300505-71300527 AGTTTTTAACACATGAAATTTGG - Intergenic
909167665 1:72249034-72249056 GGGTTTCAACATATGAATTTTGG - Intronic
909351140 1:74654709-74654731 GGGTTTCAACATATGAATTTTGG + Intronic
909351993 1:74664999-74665021 AGATTTCAACATATGAATTTTGG - Intronic
909365936 1:74822021-74822043 AGGTTTCAACATATGAATCTGGG + Intergenic
909538179 1:76761668-76761690 AGGTTTCAACACATGGATTTTGG - Intergenic
909708443 1:78615333-78615355 AGGTTGTAACATATGAATTTAGG + Intergenic
909933654 1:81527300-81527322 AAGTTTCAACATATGAATTTTGG - Intronic
909952148 1:81733630-81733652 AGGTATTAACATATGAATGTGGG + Intronic
909994932 1:82267672-82267694 ATGTTTTATCATATGTAATTGGG - Intergenic
910010090 1:82451101-82451123 GGGTTTCAACATATGAATTTTGG + Intergenic
910063633 1:83124655-83124677 AGATTTCAACATATGAATTTAGG + Intergenic
910153392 1:84183062-84183084 AGGTATTAATATATAAAATTAGG - Intronic
910261244 1:85295701-85295723 AGGTTTTCCCTTGTGGAATTGGG + Intergenic
910399201 1:86821468-86821490 AGGTTTTAAGATATAAATTTGGG + Intergenic
910483023 1:87679184-87679206 AGGTTTCAACATATGAATTTGGG - Intergenic
910595951 1:88980938-88980960 ATGTTTTAACATTTGCAACTAGG - Exonic
910706705 1:90138171-90138193 AGGCATTAACATCTGGAATCTGG + Intergenic
910773005 1:90848618-90848640 AAGTTCTAGAATATGGAATTGGG - Intergenic
910823632 1:91381089-91381111 AGGTTTTAACATTTGCTATCTGG + Intronic
911099879 1:94087161-94087183 AGATTTCAACATATGAATTTTGG + Intronic
911425709 1:97708353-97708375 ACTTTTTTACATATGGAAGTAGG + Intronic
911441197 1:97927633-97927655 AGGTTTTAACATGTAAATTTTGG + Intergenic
911710014 1:101060910-101060932 AGGTTTCAACATATTAATTTGGG + Intergenic
912003553 1:104864401-104864423 AAGTTAGAACATATGGTATTTGG + Intergenic
912309821 1:108609059-108609081 GGGTTTCAACATATGAATTTTGG + Intronic
912406003 1:109438164-109438186 AGTTTTTAATACATGAAATTTGG + Intergenic
912453109 1:109779477-109779499 AGGTTTTAACATATGAATTTTGG + Intergenic
912486556 1:110033735-110033757 AGTTTCCAACGTATGGAATTTGG + Intronic
912720856 1:112018871-112018893 AGGTTTCAACATATGAATTTGGG - Intergenic
912886780 1:113483300-113483322 AGGTTTCAACATAGGGATTGTGG - Intronic
913168206 1:116208878-116208900 AGGTCTCAACATATGAATTTGGG + Intergenic
913973256 1:143432880-143432902 AAGTTTCCACATATGAAATTTGG - Intergenic
914067642 1:144258487-144258509 AAGTTTCCACATATGAAATTTGG - Intergenic
914111513 1:144707867-144707889 AAGTTTCCACATATGAAATTTGG + Intergenic
914325523 1:146611684-146611706 AGATTTCAACATATGAATTTGGG + Intergenic
914433929 1:147643377-147643399 AGATGTCAACATATGGATTTAGG + Exonic
914508822 1:148312631-148312653 TGATTTTAACATATGAATTTGGG - Intergenic
914737539 1:150432410-150432432 AGGTTTCAACATATGAATTTCGG - Intronic
915261892 1:154682805-154682827 GGGCTTCAACATATGGATTTGGG - Intergenic
915650140 1:157303706-157303728 AGGCTTCAACATATGAATTTGGG - Intergenic
915661379 1:157408466-157408488 AGGCTTCAACATATGAATTTGGG + Intergenic
915826424 1:159082758-159082780 GGATTTTAACATATGAATTTTGG + Intronic
916264466 1:162876828-162876850 AGGTTTCAACATACGAATTTTGG - Intergenic
916736968 1:167616497-167616519 TGGTTTTAAAATATTAAATTTGG + Intergenic
917144903 1:171879561-171879583 AGCATTTACCATAAGGAATTAGG + Intronic
917286235 1:173424154-173424176 AAGTTTTAACATATGAACTTGGG + Intergenic
917563668 1:176187866-176187888 AGATTTCAACATATGAAATTTGG - Intronic
917585135 1:176418161-176418183 AGTTTTCAACACATAGAATTTGG + Intergenic
917871230 1:179243873-179243895 AGGTTTCAACATAGGAATTTTGG - Intergenic
918090927 1:181294066-181294088 AGGTTATGACATATGGCATGTGG + Intergenic
918119664 1:181527393-181527415 AGGTTTCAACATATGGATTTTGG + Intronic
918152973 1:181814470-181814492 GAGTTTTAACATATGAATTTTGG - Intergenic
918200972 1:182266611-182266633 AGGTTTCAACATATGAATTTGGG - Intergenic
918220128 1:182429148-182429170 AGGGTTCAACATATGGATTTTGG + Intergenic
918327280 1:183422076-183422098 AGGTTTCAATATATGAATTTTGG - Intergenic
918402045 1:184173382-184173404 AGATTTTAACCTATGAATTTTGG - Intergenic
918630524 1:186712145-186712167 AAGTTTTAACATATGAATTTTGG + Intergenic
918635634 1:186771019-186771041 AGGCTTTAATATATGAATTTGGG + Intergenic
918727429 1:187943419-187943441 AGATTTTAACATATGAATGTGGG - Intergenic
918728697 1:187960888-187960910 AGGTTTCAACATATGAATTTTGG + Intergenic
918759852 1:188390008-188390030 AGGTTTCAACATGTGAATTTTGG + Intergenic
918868843 1:189939373-189939395 AGGCTTCAACATATGAACTTTGG + Intergenic
919005737 1:191897139-191897161 AGGTTTCAATATATGAATTTTGG + Intergenic
919220337 1:194620066-194620088 AGTTTTAAACATATTTAATTGGG - Intergenic
919226943 1:194716340-194716362 AAGTGATAACATATGGTATTTGG + Intergenic
919338951 1:196278843-196278865 AGGTTTTCACATATGCATTGTGG - Intronic
919408331 1:197211658-197211680 AGGTTTTAGCTTATAAAATTTGG + Intergenic
919412746 1:197266465-197266487 AGGTTTCAACATGTGAATTTGGG + Intergenic
919461867 1:197886126-197886148 ATGTTTCAACATATGAATTTGGG + Intergenic
919609447 1:199726982-199727004 AGGTTCCAACATATGAATTTTGG + Intergenic
919703031 1:200651305-200651327 AGATTTCAACATATGAATTTAGG - Intronic
920047583 1:203143416-203143438 AGTTTTCAACACATGAAATTTGG + Intronic
920243428 1:204570465-204570487 AAGTTTCAACATATGAATTTTGG + Intergenic
920618083 1:207514370-207514392 GGATTTCAACATATGGATTTGGG - Intronic
920634518 1:207686757-207686779 AGATTTCAACATATGGATTTGGG - Intronic
920744367 1:208612511-208612533 AGGTTTCAACATACGAATTTTGG + Intergenic
920969742 1:210732887-210732909 AGTTTTCAACATATGAATTTGGG + Intronic
921073456 1:211681629-211681651 AGGTTTCAACATACGAATTTAGG - Intergenic
921283439 1:213588630-213588652 AGGTTACAACATATGAATTTTGG + Intergenic
921417226 1:214903314-214903336 AAGTTTCAACATATGAACTTTGG - Intergenic
921686446 1:218094613-218094635 AGGTTTCTACATATGAATTTTGG - Intergenic
921691485 1:218156415-218156437 AGGTAATAAAATATGGAATTAGG + Intergenic
921697753 1:218231684-218231706 AGGTTTCAACATATAAATTTGGG - Intergenic
921753455 1:218824795-218824817 AGGTTTCAACATATGAATTGGGG - Intergenic
921894977 1:220390474-220390496 AAGTTTCAACATATGAATTTTGG + Intergenic
921902128 1:220462635-220462657 AGGTTTCAACATGTGAAGTTTGG - Intergenic
921953018 1:220953273-220953295 AGGATTTAATACAGGGAATTAGG - Intergenic
921989649 1:221350697-221350719 AGGTTTTAACACATGAATTTGGG + Intergenic
922272455 1:224046087-224046109 AGTTTTTAAGAAATGGCATTTGG - Intergenic
922277601 1:224093525-224093547 AGGTTTCAACATATGAATTTTGG - Intergenic
922360096 1:224813330-224813352 AGGTTTTGACAAATGAATTTGGG - Intergenic
922634765 1:227156875-227156897 AGGCTTTAGCATCTGGAATTTGG - Intronic
922727472 1:227929443-227929465 AGGTTTGACCATATGAATTTGGG - Intronic
922995185 1:229951758-229951780 GGGTTTCAACATATGAATTTGGG + Intergenic
923068070 1:230538395-230538417 AAATTTTAACATATGGATTTGGG + Intergenic
923096101 1:230776352-230776374 AGGATTCAACATATGAATTTAGG + Intronic
923127359 1:231043564-231043586 AGGTTTCAACATATGAATTTGGG + Intergenic
923179394 1:231501393-231501415 AGGTTTCAACTTATGAATTTTGG + Intergenic
923390883 1:233513902-233513924 AGGTTTCAATATATGAACTTGGG + Intergenic
923469605 1:234278896-234278918 AGGATTCAACATATGAATTTTGG + Intronic
923738417 1:236633750-236633772 AGGCTTCAACATATGAATTTTGG + Intergenic
923790462 1:237106962-237106984 AGATTTTAACATATGATTTTGGG + Intronic
923889100 1:238191528-238191550 AAGTTTTAACATATGAATTTTGG - Intergenic
924009476 1:239649127-239649149 GGATTTTAACATATGAATTTAGG - Intronic
924200030 1:241649132-241649154 AGGTTTCAACATATGAATTTCGG - Intronic
924226844 1:241928973-241928995 AGGTTTCAACCTATGAATTTGGG - Intergenic
924272643 1:242349776-242349798 AGGTTTCAACATGTGAATTTTGG - Intronic
924386694 1:243505843-243505865 AAGTTTTATCATAGGGAAATTGG - Intronic
924462350 1:244270657-244270679 AGGCTTCAACATATGAATTTTGG - Intergenic
924650884 1:245926220-245926242 AGTTTTCAACAGATGGAATCTGG + Intronic
924693299 1:246373654-246373676 AGCTTTTGCCATATGGAACTTGG + Intronic
924867970 1:248006618-248006640 AGATTTAAGCATATGGATTTGGG - Intronic
924872510 1:248064151-248064173 AGATTTAAGCATATGGATTTTGG - Intronic
1062782231 10:224025-224047 TATTTTTACCATATGGAATTTGG - Intronic
1063345013 10:5303611-5303633 AGGATTCAACATATGAATTTTGG - Intergenic
1063817145 10:9788353-9788375 AGGATTCAACATATGAATTTTGG + Intergenic
1063897578 10:10698064-10698086 AGGTTTTAACATATCAATTGGGG + Intergenic
1063960899 10:11304752-11304774 AGTTTCCAACATATGGAATTTGG + Intronic
1063977246 10:11427288-11427310 AGGTTTTAACATATGAATTTAGG + Intergenic
1064277696 10:13921671-13921693 AGGTTTCAACAGATGAATTTTGG + Intronic
1064298035 10:14096079-14096101 AGATTTCAACATATGAATTTTGG - Intronic
1064740970 10:18434307-18434329 GTGATTTAACATAGGGAATTAGG + Intronic
1064741605 10:18440285-18440307 AAGTTTCAACATATGAATTTTGG + Intronic
1064742611 10:18449074-18449096 TCGTTTTAGCATAAGGAATTTGG - Intronic
1064963309 10:20990308-20990330 AGGCTTCAACATATGAATTTGGG - Intronic
1065114390 10:22470573-22470595 AGGTTTCAACATATGAATTTTGG + Intergenic
1065256880 10:23878956-23878978 AGTTTAGAACATGTGGAATTGGG + Intronic
1065494210 10:26312344-26312366 AGGTTTCCACATATGAAATCTGG - Intergenic
1065784182 10:29198295-29198317 AGGCTTCAACATATGAATTTTGG - Intergenic
1066232587 10:33451305-33451327 AGTTTTCAACATATGCATTTTGG + Intergenic
1066404516 10:35106044-35106066 AGGTTTCAACATACGAATTTTGG - Intergenic
1066444365 10:35468330-35468352 AGGATTTAACGTATGAATTTTGG + Intronic
1066458305 10:35590881-35590903 GGATTTCAACATATGGATTTGGG + Intergenic
1066524502 10:36261851-36261873 AAGTTTTAACATCTGAATTTTGG - Intergenic
1066645969 10:37609539-37609561 AGGTTTTAACATACAAATTTTGG - Intergenic
1067171677 10:43912156-43912178 AGGTTTCAACATATGGATTCTGG + Intergenic
1067549816 10:47226382-47226404 GGGCTTCAACATATGGATTTGGG + Intergenic
1067659464 10:48223702-48223724 GGGTTTCAACATATGGATTTGGG - Intronic
1067736764 10:48860582-48860604 GGATTTTAACATATGAATTTGGG + Intronic
1067977508 10:51042764-51042786 AGGATTTAACATATGAATTGTGG - Intronic
1068345815 10:55776451-55776473 AGATTTCAACATATGAATTTCGG - Intergenic
1068450074 10:57175023-57175045 AGGTTTTAACATATGAATTTTGG - Intergenic
1068720740 10:60243267-60243289 AGTTTCTAACATATAAAATTAGG - Intronic
1068733539 10:60386785-60386807 AGTTTATAAAATAAGGAATTTGG - Intronic
1068927790 10:62558021-62558043 AAGTTTCAACATATGAATTTTGG - Intronic
1069083301 10:64111479-64111501 AAGTTTCAACATGTGGATTTTGG - Intergenic
1069183557 10:65393539-65393561 ATATTTTAACATATGAATTTTGG + Intergenic
1069213135 10:65786772-65786794 GGGTTTCAACATATGAATTTGGG + Intergenic
1069258708 10:66366414-66366436 AGGTTTTAACATATGAATTTTGG - Intronic
1069526022 10:69172543-69172565 AGGTTTAAAGAAATGTAATTTGG - Exonic
1069649559 10:70035469-70035491 AGGTTTCAACATATGAATTCTGG + Intergenic
1069656339 10:70092021-70092043 AGGTTTCAACATATGAATTGTGG - Intronic
1069692437 10:70362852-70362874 AGATTTTAACCTATGAATTTTGG - Intronic
1069700110 10:70418033-70418055 AGGTTTCAACATAAGAATTTTGG - Intronic
1069732665 10:70628564-70628586 AGGTTTCAACATATAGATTCAGG + Intergenic
1070573260 10:77657685-77657707 AGGTTTCAACATATAAATTTCGG - Intergenic
1070604145 10:77886690-77886712 GGGCTTTAACATATGGATTTTGG - Intronic
1070693609 10:78545412-78545434 AGGTTTCAACATATGAATTTTGG + Intergenic
1071020181 10:81044708-81044730 AGGTGAGAACATATGGTATTTGG + Intergenic
1071151416 10:82639408-82639430 AGGTTTGAACATATGAATTTTGG + Intronic
1071177258 10:82940859-82940881 AGGTACTAACATATGCATTTTGG + Intronic
1071260996 10:83918837-83918859 AGATTTCAACATATAGACTTTGG - Intergenic
1071548758 10:86549613-86549635 GGGTTTCAACATATGAATTTTGG - Intergenic
1071621889 10:87128041-87128063 AGGTTAAAAAATATGGAATATGG - Intronic
1071745079 10:88408353-88408375 AGGTTCTAACATATGAATTTTGG - Intronic
1072000452 10:91190302-91190324 AGATTTCAACATATGAATTTTGG + Intronic
1072171074 10:92862339-92862361 AGGTTTTAACATATGAATTATGG - Intronic
1072362556 10:94674115-94674137 AGGTTTCAACATATGAATTTTGG - Intergenic
1072379389 10:94851841-94851863 ATGTTTCAACATATGAAATGGGG + Intronic
1072391110 10:94987924-94987946 ATGTGTCAACATATGAAATTGGG + Intronic
1073470451 10:103718869-103718891 AGGATTTAACATATGAATTTAGG - Intronic
1073646602 10:105311151-105311173 AGGTTTCAACATATAAATTTTGG - Intergenic
1073675175 10:105638698-105638720 GAGCTTTAACATATGGATTTGGG - Intergenic
1073703711 10:105958814-105958836 AGGTTCCAACGTATGGATTTTGG - Intergenic
1073806727 10:107106724-107106746 AGGTTTAAACATATGAATTTGGG - Intronic
1073807768 10:107118044-107118066 AGGTTTCAACATATGAATTTTGG - Intronic
1073821630 10:107271004-107271026 AGGCTTTAACATATAAAATGAGG + Intergenic
1074148317 10:110736775-110736797 AGGTTTCAAAATATGCATTTTGG - Intronic
1074234210 10:111568553-111568575 AGGCTTCAACATATGAATTTTGG - Intergenic
1074622613 10:115141431-115141453 AGATTTTAACATTTGCCATTGGG + Intronic
1074955844 10:118388472-118388494 GGGCTTCAACATATGGATTTTGG - Intergenic
1075025903 10:118982825-118982847 AGGCTTCAACATATGAATTTTGG - Intergenic
1075113236 10:119604903-119604925 AGGTTTTAACATATGAATTTTGG - Intergenic
1075200468 10:120399154-120399176 TGCTTTTAACATATTCAATTAGG - Intergenic
1075260244 10:120957234-120957256 GGGTTTTAACATATGAATTTTGG + Intergenic
1075312201 10:121423758-121423780 TGGTTTTAACATTTGAATTTTGG + Intergenic
1075362754 10:121854028-121854050 AGGTTCTAACATATAAATTTTGG + Intronic
1075378901 10:122002280-122002302 AGATTTCAACATATGAATTTGGG + Intronic
1075448437 10:122530051-122530073 AGGTTTCAACACATGAACTTTGG + Intergenic
1075510422 10:123067752-123067774 AGGTTTCAACATAGGGATTTGGG + Intergenic
1075901418 10:126045416-126045438 AAGTTTTAAAATAAAGAATTTGG + Intronic
1076060122 10:127407475-127407497 AGGTTTCAACATCTGAATTTTGG + Intronic
1076115655 10:127896397-127896419 AGGTTTTTACATATGTAAATTGG + Intergenic
1076350835 10:129814233-129814255 GGGTTTCAACATATGAATTTGGG - Intergenic
1076599738 10:131649701-131649723 AGGTTTTAACAAATGGCACCTGG - Intergenic
1077683472 11:4268975-4268997 GAGTTTTAACATATGAATTTTGG + Intergenic
1077686568 11:4297786-4297808 GAGTTTTAACATATGAATTTTGG - Intergenic
1077691721 11:4348976-4348998 GAGTTTTAACATATGAATTTTGG - Intergenic
1077861357 11:6183694-6183716 AGGTTTTAACATATAAACTTGGG + Intergenic
1077878484 11:6327763-6327785 AGTTTCTAACACATGTAATTTGG + Intergenic
1077956638 11:7027544-7027566 AGGTTTCAGCATATGAATTTGGG + Intronic
1077993574 11:7433559-7433581 AGGTTTCAACATATGAATTTTGG - Intronic
1078258939 11:9685970-9685992 AAGTTTCAACATATGAATTTTGG + Intronic
1078320762 11:10332590-10332612 AGGTTTCAACGTATGAATTTGGG - Intronic
1078471918 11:11595176-11595198 AGATTTCAACATATGAATTTTGG - Intronic
1078472617 11:11603885-11603907 GGATTTCAACATATGGATTTGGG - Intronic
1078640739 11:13093454-13093476 AGGTTTTGACATATGAATTTTGG - Intergenic
1078772688 11:14365422-14365444 GAGTTTTAACATATGAATTTTGG - Intergenic
1078814785 11:14809587-14809609 AGGTTTCAACATGTGAATTTTGG - Intronic
1078867697 11:15313145-15313167 GGGTTTCAACATATGAATTTTGG - Intergenic
1078879039 11:15429690-15429712 AGTTTTTAACATATACATTTGGG + Intergenic
1078947299 11:16083829-16083851 AGCTTTTATCAAATGGGATTAGG - Intronic
1079044752 11:17091417-17091439 ATGTTTTGACATATGGATTTGGG + Exonic
1079345644 11:19649684-19649706 AGTTTTCAACATATGAATTTGGG + Intronic
1079358741 11:19752863-19752885 AGGCTTCAACATATGAATTTGGG - Intronic
1079611372 11:22436442-22436464 AGGTTTGAACACATGAATTTTGG + Intergenic
1079713515 11:23716664-23716686 AGATTTTAACATATGAATTTGGG - Intergenic
1079798654 11:24841093-24841115 GGGCTTTAACATATGAATTTTGG - Intronic
1079818859 11:25098289-25098311 AGATTTCAACATATGAATTTTGG - Intergenic
1079845183 11:25457520-25457542 AGGTTTCAACATATAAATTTTGG + Intergenic
1079880963 11:25925805-25925827 AGATTTCAACATATGGATTTTGG - Intergenic
1080133583 11:28826147-28826169 AGGTTGCAACATATGAATTTTGG + Intergenic
1080178225 11:29392887-29392909 AAGTTTTAACATATAAATTTTGG + Intergenic
1080183513 11:29451969-29451991 GGGATTTAACATATGAATTTTGG - Intergenic
1080199359 11:29650552-29650574 GGATTTTAACATATGAATTTTGG - Intergenic
1080231756 11:30024184-30024206 GGGCTTCAACATATGGATTTTGG - Intergenic
1080308838 11:30866539-30866561 GGGTTTCAACATATGAATTTTGG + Intronic
1080450071 11:32371796-32371818 GGATTTCAACATATGAAATTTGG - Intergenic
1080492729 11:32783754-32783776 AGGTTTCAACGTATGAATTTGGG + Intronic
1080587292 11:33693564-33693586 AGGTTTCAACATATGAATTTTGG + Intergenic
1080805090 11:35645676-35645698 AGATTTTAACGTATGAATTTTGG + Intergenic
1081098805 11:38975349-38975371 AGGTTTCAACATATGAATTCAGG + Intergenic
1081118038 11:39229501-39229523 CGGTTCTAACATATGAATTTTGG + Intergenic
1081139576 11:39482009-39482031 AGGTTTCAGCATATGAATTTGGG + Intergenic
1081142042 11:39513396-39513418 AGGTTTTAACATAGGAATTTGGG + Intergenic
1081362100 11:42192925-42192947 AGATTTTAACACATGAATTTTGG - Intergenic
1081491608 11:43573795-43573817 ATGTTTTTAGATATGAAATTAGG - Intronic
1081535103 11:43990558-43990580 AAGTTTCAACATATGAATTTGGG + Intergenic
1081592297 11:44432827-44432849 AGGTTTCAACATAAGAATTTTGG + Intergenic
1081766492 11:45614861-45614883 AAGTTTTAAAAAATGCAATTTGG - Intergenic
1082066325 11:47903631-47903653 AGGTTCTAACATATGAATTTTGG - Intergenic
1082122876 11:48398304-48398326 AAGTTTTAACATATGAATTTTGG + Intergenic
1082251795 11:49990672-49990694 AAGTTTTAACGTATGAATTTTGG - Intergenic
1082556574 11:54569580-54569602 AAGTTTTAACATATGAATTTTGG + Intergenic
1082656384 11:55863248-55863270 AGGTTTAAGCGTATGAAATTAGG - Intergenic
1082885258 11:58075446-58075468 AGGTTTCAATGTATGGATTTGGG - Intronic
1083916529 11:65748194-65748216 GGGCTTTAACATATGAATTTGGG + Intergenic
1084091953 11:66884654-66884676 AGGTTTCAACATATGGGTGTGGG - Intronic
1084217365 11:67656296-67656318 GAGTTTTAAAATATGGATTTAGG + Intergenic
1084490492 11:69475858-69475880 AGGCTTCAACATATGTATTTAGG + Intergenic
1084524889 11:69690487-69690509 AGTTTTTAACATATGAGTTTTGG + Intergenic
1085074589 11:73579194-73579216 GGGTTTCAACATATGAATTTTGG + Intronic
1085326676 11:75611565-75611587 AGTTTCTAAGAAATGGAATTTGG - Intronic
1085368028 11:75970794-75970816 ATGTTTTAACAGAAGAAATTGGG - Intronic
1085445963 11:76601056-76601078 AAGTTTCAACATATGAATTTTGG - Intergenic
1085446262 11:76603203-76603225 GGATTTCAACATATGAAATTTGG + Intergenic
1085872087 11:80362492-80362514 TAGTTTTAACATATGAATTTAGG + Intergenic
1085884025 11:80500939-80500961 AGATTTCAACATATGGATTTTGG - Intergenic
1085911511 11:80832390-80832412 AAGTTTCAACATGTGGATTTGGG + Intergenic
1085914212 11:80865417-80865439 AAGTTAGAACATATGGCATTTGG - Intergenic
1085967349 11:81543886-81543908 AGGCTTCAACATATGAATTTTGG - Intergenic
1086006464 11:82044417-82044439 AGGTTTCAACATATGAATTTGGG - Intergenic
1086051850 11:82601387-82601409 GGATTTCAACATATGGATTTAGG + Intergenic
1086238250 11:84658342-84658364 AGATTTCAACATATGAAATTTGG - Intronic
1086426496 11:86688865-86688887 GGGTTTCAACATATGAATTTGGG + Intergenic
1086737770 11:90328451-90328473 GGGTTTCAACATATGAATTTTGG - Intergenic
1086762904 11:90655865-90655887 AGGTTTAAAAATATGTAATTAGG - Intergenic
1086790408 11:91030588-91030610 AGGTTTCAACAAATGAATTTGGG - Intergenic
1086932057 11:92704438-92704460 GGATTTTAACACATGGATTTTGG - Intronic
1087149363 11:94844779-94844801 AGTTTCTAACACATGAAATTTGG + Intronic
1087174067 11:95080105-95080127 GGGTTTCAACATATGAATTTTGG - Intergenic
1087224072 11:95578477-95578499 AAGTTTCAACATATGAATTTGGG + Intergenic
1087334563 11:96826857-96826879 GGGATTCAACATATGGATTTTGG + Intergenic
1087422487 11:97947901-97947923 AGGTTTCAAAATATGCATTTGGG + Intergenic
1087678433 11:101189800-101189822 AGGTTTCAATATATGTATTTTGG - Intergenic
1088040814 11:105379644-105379666 AAGTTTCAACATATGGATTTTGG - Intergenic
1088119510 11:106351556-106351578 ACATTTTAACATATGAATTTTGG + Intergenic
1088445262 11:109919677-109919699 AGGTTTCAACATATAAATTTTGG + Intergenic
1088568818 11:111201284-111201306 AGGTTTCAGCATATGAATTTTGG + Intergenic
1088725004 11:112626654-112626676 AGGTTTCAACATATGAATTTTGG + Intergenic
1088875176 11:113929597-113929619 GGGTTTCAACATATGGGTTTTGG + Intronic
1089115828 11:116094310-116094332 GGGTTTCAACATATGGATTAGGG - Intergenic
1089486419 11:118849903-118849925 AGGTTTCAACATATGAATTTTGG - Intergenic
1089827045 11:121287458-121287480 AGATTTCAACATATGAATTTGGG + Intergenic
1090076385 11:123582389-123582411 AGTTTTTAATATTTGGATTTGGG + Intronic
1090257534 11:125295875-125295897 AGCTTTTAACATATTGAACGGGG - Intronic
1090346431 11:126075356-126075378 AGGTTCTGACATATGAATTTGGG - Intergenic
1090537720 11:127662742-127662764 AGGTTTTAACATATGAATTTTGG + Intergenic
1090651915 11:128814384-128814406 AGGTTTCAGCATATGAATTTGGG + Intergenic
1090771360 11:129922235-129922257 AGGTGTTAAAATATGGTATCTGG + Intronic
1090822955 11:130361220-130361242 GGATTTTAACATATGAATTTTGG + Intergenic
1090992806 11:131835164-131835186 AAGATTTAACATATGTATTTGGG + Intronic
1091088013 11:132742252-132742274 GGGTTTCAACATATGAATTTTGG - Intronic
1091126057 11:133099139-133099161 AGTTTTCTTCATATGGAATTTGG - Intronic
1092128875 12:6094563-6094585 AGGTTCCAACACATGGATTTTGG - Intronic
1092661111 12:10739463-10739485 GGGCTTCAACATATGAAATTTGG - Intergenic
1092668131 12:10830038-10830060 AAGTTTCAACATATAGACTTTGG - Intronic
1092829561 12:12430507-12430529 AGGTTTTTACTTATGGAGTAGGG + Intronic
1092933818 12:13341546-13341568 AGGTTTCAGCATATGAACTTTGG - Intergenic
1092949503 12:13488180-13488202 AGGTTTCAGCATATGAATTTTGG - Intergenic
1093132210 12:15405117-15405139 AGGCTTCAACATATGAATTTGGG + Intronic
1093378792 12:18464396-18464418 AGGTTTCAGCATATGCATTTGGG + Intronic
1093439243 12:19173880-19173902 AGGTTTTAAGTATTGGAATTAGG + Intronic
1093730057 12:22556951-22556973 AGGTTTCAACATATGATTTTTGG - Intergenic
1093769613 12:23003433-23003455 TGGTTTTAACATATGAAATTTGG + Intergenic
1094378998 12:29822181-29822203 AGGTTTTATCACATGAATTTTGG + Intergenic
1094727894 12:33141428-33141450 AGGTTTCAACATAAGAATTTTGG + Intergenic
1095379660 12:41575206-41575228 GGGTTTCAACATATGAATTTTGG + Intergenic
1095471585 12:42542872-42542894 AGGTTTCACCATATGAATTTGGG - Intronic
1095511827 12:42959416-42959438 AGGTTTTAACATATTAATCTGGG - Intergenic
1095576003 12:43740112-43740134 AGGATTTAAAATATTAAATTTGG - Intronic
1095633120 12:44400947-44400969 AAGTTTCAACATATTAAATTTGG + Intergenic
1095933531 12:47652825-47652847 GGATTTCAACATATGGATTTTGG + Intergenic
1096911712 12:54990685-54990707 AAGTTTCAACATATGAATTTGGG + Intergenic
1097038693 12:56141336-56141358 AGGTTGTTACATTTGGAATATGG + Intronic
1097409814 12:59237946-59237968 AGATTTTAACATATGAATTGAGG - Intergenic
1097738902 12:63215361-63215383 AGGTTTTAACATATGAATGGAGG - Intergenic
1097833002 12:64245397-64245419 AGGTTTCAACATATGATTTTTGG - Intergenic
1097982425 12:65748089-65748111 AAGTTTCAACATATGAATTTTGG - Intergenic
1098067664 12:66636542-66636564 AGGGTTCAACATATGAATTTAGG - Intronic
1098164264 12:67677407-67677429 GGGCTTTAACATATGAATTTTGG + Intergenic
1098165243 12:67690272-67690294 AGGTTTTGCCATATGAATTTTGG - Intergenic
1098190867 12:67946881-67946903 AAGTTTTACCATATGAATTTTGG - Intergenic
1098300459 12:69048674-69048696 GGGTTTCAACATATGAATTTTGG + Intergenic
1098527063 12:71498673-71498695 AGGGTTTAGCATATGAATTTGGG + Intronic
1098535752 12:71592038-71592060 AGGCTTCAACATATGAATTTGGG - Intergenic
1098547387 12:71726932-71726954 GGGCTTCAACATATGGATTTTGG - Intergenic
1098636143 12:72785995-72786017 AGGTTCCAACATATGAAATTTGG + Intergenic
1098806186 12:75022534-75022556 TGGTTTCAACATATGAATTTTGG + Intergenic
1098913437 12:76233654-76233676 AGAATTTAACATAGGGGATTGGG - Intergenic
1098914372 12:76241743-76241765 AAGTTTCAACATATGAATTTGGG - Intergenic
1098950852 12:76639214-76639236 AGATTTCAACATATGAATTTTGG + Intergenic
1098986470 12:77017813-77017835 AGGTTTTAATACAGGGAATTAGG + Intergenic
1099072701 12:78065972-78065994 AGGTTTTAACACATGAATTGTGG - Intronic
1099109314 12:78537633-78537655 GGATTTCAACATATGGATTTTGG + Intergenic
1099161456 12:79246743-79246765 AAGTTTCAACATATGAATTTTGG + Intronic
1099219587 12:79897303-79897325 AAGTTAGAACATATGGTATTTGG - Intronic
1099222212 12:79928462-79928484 AGGTTTTTAAAAATGGATTTAGG + Intronic
1099232319 12:80041115-80041137 GGATTTTAAAATATGAAATTTGG - Intergenic
1099274981 12:80563496-80563518 AGGTTTCAACATATGAATTTTGG + Intronic
1099390354 12:82071644-82071666 AGATTTTAACATATGGATTTGGG - Intergenic
1099709308 12:86200742-86200764 AGGTCTCAACATATGGATATTGG - Intronic
1099818279 12:87675977-87675999 AGGTTTCAAAATACGGATTTTGG + Intergenic
1099967127 12:89459768-89459790 AGGTTTTTACAAATAGTATTTGG - Intronic
1100030775 12:90187914-90187936 AGATTTCAACATATGGATTTGGG + Intergenic
1100100412 12:91096846-91096868 AGTTTTCGACATATGAAATTTGG + Intergenic
1100298081 12:93281190-93281212 AGGTTTTAACATATGAATTTGGG + Intergenic
1100333776 12:93610526-93610548 AGGTTTCAACATATGGACTTTGG - Intergenic
1100374208 12:93997588-93997610 AGGTTTCAATATATGAATTTTGG - Intergenic
1100567031 12:95806462-95806484 AGGTTTCAACACATGAATTTTGG - Intronic
1100667529 12:96771156-96771178 AGGCCTTAACAGATGGAACTGGG + Intronic
1100779667 12:98010544-98010566 GGATTTCAACATATGGACTTTGG - Intergenic
1100784931 12:98068888-98068910 AGATTTTAGCATTTGGACTTTGG + Intergenic
1100841239 12:98613405-98613427 AGGTTTTAGCATATTTATTTTGG + Intronic
1100869026 12:98891229-98891251 TGGTTTTCTCATATGGAAATAGG - Intronic
1101045163 12:100797911-100797933 TGGTTTCAACATTTGGAGTTTGG - Intronic
1101314654 12:103618148-103618170 AGGTATGAACATATGAATTTTGG - Intronic
1101614118 12:106319316-106319338 GGGTTTCAACATATGAATTTGGG + Intronic
1101715912 12:107311792-107311814 AGGTTTACACATATGCATTTGGG + Intergenic
1101743773 12:107522240-107522262 GGGCTTCAACATATGGATTTGGG + Intronic
1102493923 12:113306333-113306355 AGGCTTTAAAATAGGGATTTGGG - Intronic
1102696515 12:114803890-114803912 AGGTTTCAACATATGAATTTGGG - Intergenic
1102870270 12:116408755-116408777 AGATTTCAACATAAGGATTTGGG - Intergenic
1102981818 12:117247609-117247631 GAGTTTTAATATATGAAATTTGG - Intronic
1103015144 12:117488426-117488448 GGATTTCAACATACGGAATTGGG - Intronic
1103128376 12:118445022-118445044 AGGCTTCAACATATGAATTTTGG - Intergenic
1103222149 12:119254870-119254892 GGATTTCAACATATGGATTTGGG + Intergenic
1103300983 12:119926555-119926577 AGGTTTCAACATATGGATTGAGG - Intergenic
1103483322 12:121265458-121265480 AGGTTTTGACATATGAATTTTGG - Intronic
1104167229 12:126244356-126244378 AGGTTTCAATATATGAATTTGGG + Intergenic
1104297512 12:127530393-127530415 AGATTTTGACATACGGATTTTGG - Intergenic
1104578343 12:129989236-129989258 AAGTTGCAACATATGAAATTTGG - Intergenic
1104805210 12:131585692-131585714 AGGTTTCAACATACGAAATTTGG - Intergenic
1105464008 13:20620473-20620495 AGGTTTCAACATATGAATTTTGG - Intronic
1105530612 13:21215839-21215861 AGGTTTAAGCATATGGCATCTGG + Intergenic
1105923980 13:24989925-24989947 AGGTTTAAGCATATGGCATCTGG - Intergenic
1105957729 13:25300380-25300402 GGGCTTTAACATATGGATTGGGG + Intergenic
1106001697 13:25729517-25729539 AGGGTTTAAGATCTGGATTTGGG + Intronic
1106307391 13:28525529-28525551 GGGTTTGAACATATGAATTTTGG - Intergenic
1106374902 13:29176748-29176770 AGGTTTCAACATATGAATTTGGG + Intronic
1106592367 13:31108979-31109001 AGATTTCAACATATGAATTTGGG + Intergenic
1106678937 13:31990044-31990066 AAGTTTCAACATATGAATTTTGG - Intergenic
1106929137 13:34645012-34645034 ATTTTTAAAAATATGGAATTAGG + Intergenic
1107148592 13:37086546-37086568 AGGTTCCAACATATGAACTTTGG + Intergenic
1107298366 13:38939215-38939237 AGGTTTTAACATATAAATTTTGG - Intergenic
1107348399 13:39488008-39488030 AGGTTTCAACATATAAATTTTGG - Intronic
1107376706 13:39811720-39811742 AGGTTTCAATATATGAATTTGGG + Intergenic
1107410577 13:40154246-40154268 AGGCTTTAACATATGAATTTTGG + Intergenic
1107426836 13:40302396-40302418 ACCTTGTAACATATGTAATTGGG - Intergenic
1107817629 13:44258368-44258390 AGATTTCAACATATGAATTTTGG - Intergenic
1108199726 13:48031264-48031286 AGTTTTTAACACATGAACTTTGG + Intergenic
1108273521 13:48785802-48785824 GGGCTTTAACATATGAATTTTGG - Intergenic
1108568035 13:51720899-51720921 AGGTTTTGACATATGAATTTTGG + Intronic
1108781062 13:53834600-53834622 AGTTTTCAACATATGAAATTTGG - Intergenic
1108799355 13:54074688-54074710 TGGTTTAAATATATGTAATTCGG + Intergenic
1108931722 13:55832521-55832543 AGGTTTCAACATATAAATTTGGG - Intergenic
1109142640 13:58734248-58734270 AGGTTTTAACGTATGAATTTTGG - Intergenic
1109333142 13:60957337-60957359 AGGTTTCAACATACGAATTTTGG - Intergenic
1109436707 13:62313111-62313133 GGATTTCAACATATGGATTTTGG - Intergenic
1109478116 13:62911645-62911667 AGGTTTCAACATATGAATTTTGG + Intergenic
1109528900 13:63614481-63614503 AAATTATGACATATGGAATTAGG - Intergenic
1109550303 13:63887909-63887931 AGATTTCAACATATGAAATTTGG - Intergenic
1109677262 13:65694290-65694312 AGATTTCAACATATGGATTTAGG - Intergenic
1109754079 13:66736197-66736219 GGGCTTCAACATATGCAATTGGG - Intronic
1109767857 13:66928512-66928534 AGTTTTCAACATATGAATTTGGG - Intronic
1109979493 13:69888273-69888295 AGGTTTTAACATATGGAATTTGG + Intronic
1110054216 13:70944052-70944074 AGGTTTCAACATATGAATTTTGG + Intergenic
1110177321 13:72573006-72573028 GGGTTTCAACATATGAATTTTGG - Intergenic
1110241249 13:73269754-73269776 AGGATTTAACATGTGAATTTGGG - Intergenic
1110262509 13:73501322-73501344 AGGTTTCAACATATGAATTTTGG - Intergenic
1110266384 13:73542356-73542378 AGATTTCAACATATGAAATTTGG + Intergenic
1110407331 13:75165431-75165453 AAGTTTCAACATATGAATTTTGG - Intergenic
1110413892 13:75231702-75231724 AGGTTTCAACATAAGCATTTTGG - Intergenic
1110917109 13:81034559-81034581 AGGCTTTAACATGTTTAATTGGG - Intergenic
1111014951 13:82367823-82367845 AGGTTTTACCATATAAATTTAGG + Intergenic
1111081550 13:83316513-83316535 CGTTTTTAACACGTGGAATTTGG + Intergenic
1111211973 13:85091271-85091293 AGGTTTAAACATATAAATTTGGG - Intergenic
1111224809 13:85255403-85255425 GGGTTCAAACATATGGATTTTGG - Intergenic
1111317215 13:86578250-86578272 AGGTTTCAACATTTGAATTTTGG + Intergenic
1111497419 13:89070483-89070505 AGATTTTAACAAATGGATTTAGG - Intergenic
1111563656 13:89986151-89986173 GGGTTTCAACATATGAATTTGGG - Intergenic
1111618983 13:90699370-90699392 AAGTTTTAACATATAAATTTCGG - Intergenic
1111686505 13:91507740-91507762 AGGTTTCAACATATGAATTTTGG + Intronic
1111883512 13:93988752-93988774 AGGTTTTAACATGGGGATTACGG + Intronic
1112057356 13:95702467-95702489 AGGTTTCAACATATGAATTGGGG - Intronic
1112102395 13:96203463-96203485 AGCTTTCAACATATGGATTCTGG + Intronic
1112240490 13:97676762-97676784 AGATTTTAACATATGAATTTTGG + Intergenic
1112251221 13:97782319-97782341 AGGTTTCAACATGTGAATTTTGG - Intergenic
1112512996 13:100026508-100026530 GGGTTTTAAGATATGGATCTTGG + Intergenic
1112646292 13:101336565-101336587 AGGAGTTAACATGTGGATTTTGG - Intronic
1112721527 13:102251453-102251475 ATGTTTTAAAAGATTGAATTTGG - Intronic
1112732518 13:102381298-102381320 AGGTTTCAACATATTAATTTTGG - Intronic
1112742742 13:102493838-102493860 ATGTTTCAACATATGAATTTTGG - Intergenic
1112896556 13:104306448-104306470 GGATTTTAACATATGAAGTTTGG - Intergenic
1113038724 13:106080966-106080988 AGGTTTCAACACATGAATTTTGG + Intergenic
1113131788 13:107045175-107045197 AGATCTTAACATATGAATTTTGG - Intergenic
1113171559 13:107510535-107510557 AGGTTTTAAAGTATGTAATGTGG - Intronic
1113212007 13:107994298-107994320 AGATTTCAACATATGCATTTTGG + Intergenic
1113236694 13:108283942-108283964 AGGTTTCAACATAGGAATTTGGG + Intronic
1113712005 13:112471726-112471748 TAATTTTAACATATGGAATGAGG - Intergenic
1113980581 13:114271393-114271415 AGGTTTTAATATATGGGAAATGG + Intronic
1114171490 14:20277287-20277309 AAGTTTTAACATATGAAATTCGG + Intronic
1114253486 14:20981591-20981613 AGATTTTCACATAAAGAATTTGG - Intergenic
1114366080 14:22028500-22028522 AGATTTCAACATATGAATTTGGG - Intergenic
1114529533 14:23387283-23387305 AGGTTTTAAAAGTTGGAATCTGG - Intronic
1114814091 14:25936033-25936055 AGGCTTCAACATATGAATTTGGG - Intergenic
1114832956 14:26167304-26167326 AGGTTTAAATATATTAAATTTGG + Intergenic
1114888262 14:26882472-26882494 AGTTTTCAACATATGAACTTTGG - Intergenic
1114910584 14:27190888-27190910 AGATTTTAACATATGGATTTTGG - Intergenic
1115050252 14:29051557-29051579 AGGATTTAAAAAATGCAATTAGG + Intergenic
1115106641 14:29769904-29769926 AGGTTTCAACATATGAATTATGG - Intronic
1115108796 14:29795694-29795716 TTGTTTTAATATCTGGAATTGGG - Intronic
1115311854 14:31986393-31986415 AGATTTTAACCTATGAATTTGGG + Intergenic
1115525166 14:34272555-34272577 AGGTTTCAACATATAAATTTTGG + Intronic
1115705562 14:35994590-35994612 AGGTTTCAACATGTGAATTTGGG - Intergenic
1115987994 14:39122266-39122288 AGGTTTTAACATACAAATTTGGG + Intronic
1116040687 14:39683169-39683191 AGGATTTCACATATGGACTCTGG + Intergenic
1116086149 14:40240512-40240534 AAGCTTTAACATATGAATTTTGG + Intergenic
1116088968 14:40279296-40279318 AGGCTTTAGCATATGAATTTTGG + Intergenic
1116127703 14:40809325-40809347 AGATTTCAACATATGAATTTTGG - Intergenic
1116500503 14:45615866-45615888 GGGTTTTAACATATGAACTTTGG - Intergenic
1116528843 14:45941186-45941208 AGGTTTCAACATATGGATTTTGG + Intergenic
1116585482 14:46697723-46697745 AGGTTTTAACAGATGAATTTTGG + Intergenic
1116664855 14:47761400-47761422 CGGTTTCAACATATGAATTTAGG + Intergenic
1116734947 14:48677524-48677546 AAGTTTCAACATATGAATTTAGG - Intergenic
1116802285 14:49455338-49455360 AGGTTTTAAGAAATAGAATGTGG - Intergenic
1116809300 14:49523986-49524008 AGGCTTCAACATATGAATTTTGG - Intergenic
1117052945 14:51880331-51880353 AGGCTTTAAAATGTGGAAATTGG + Intronic
1117185450 14:53235236-53235258 AGGTCTTAACATTTGTATTTAGG + Intergenic
1117287794 14:54304127-54304149 AGGTTTCAACATATGAATTTTGG - Intergenic
1117468001 14:56013607-56013629 AGTTTTTATCATATGAACTTTGG - Intergenic
1117472729 14:56062726-56062748 AGTTTTTAACACATGAACTTTGG + Intergenic
1117514441 14:56486477-56486499 AAGTTCTAACATATGGATTTTGG + Intergenic
1117564223 14:56977072-56977094 AGGTTTCAACATATGAATTTGGG - Intergenic
1117573896 14:57078434-57078456 GGATTTTAACATATGAATTTTGG - Intergenic
1117755621 14:58971351-58971373 TGCTTTTAACATATGAATTTGGG + Intergenic
1117901495 14:60538569-60538591 AGGCTTCAACATATGAATTTTGG - Intergenic
1118226677 14:63907040-63907062 AGATTTCAACATATGGACTTTGG + Intronic
1118397721 14:65351788-65351810 AGTTTCTAACACATGAAATTTGG - Intergenic
1118677859 14:68207812-68207834 AGGTTTTTAAATCTGGATTTAGG + Intronic
1118706061 14:68481361-68481383 AATTTTTGACATTTGGAATTAGG - Intronic
1118756959 14:68851915-68851937 AGGTTTCAACATATGAGTTTTGG - Intergenic
1118928054 14:70212165-70212187 AGGCTTCAACATATGAATTTGGG - Intergenic
1119140427 14:72262557-72262579 AGGTTTCAACATATAAATTTGGG + Intronic
1119148719 14:72339134-72339156 GGGTTTCAACATATGAATTTTGG - Intronic
1119181387 14:72607522-72607544 AGATTTCAACATATGGATTTTGG + Intergenic
1119273239 14:73328445-73328467 AGGTTTTCATATAAGAAATTTGG + Intronic
1119275862 14:73354908-73354930 AGATATTAACATTTGGTATTTGG + Intronic
1119911272 14:78351808-78351830 AGGTTTTAACATTTTGATGTTGG + Intronic
1119911491 14:78353562-78353584 AGGTTTCAACACATGAATTTTGG + Intronic
1120159110 14:81127147-81127169 AGTTTTTAGCATGTAGAATTAGG + Intronic
1120420813 14:84283829-84283851 AGGTTTCAACATATGAATTTAGG - Intergenic
1120462731 14:84817884-84817906 AGGTTTCAGCATATGGATTTTGG - Intergenic
1120482620 14:85071280-85071302 AGGTTTTAATATATAAATTTTGG - Intergenic
1120483753 14:85084674-85084696 AGGTTTCAACATATGAATTTTGG + Intergenic
1120608286 14:86606958-86606980 GGGTTTCAACATATGAATTTTGG - Intergenic
1120614793 14:86690128-86690150 GGATTTTAACATATGCATTTTGG - Intergenic
1120670121 14:87353671-87353693 AGGTTTCAACATATAAATTTGGG - Intergenic
1120794251 14:88614785-88614807 AAGTTTTTACAAATGGAGTTGGG + Exonic
1120824572 14:88943819-88943841 AGGTTTCAACATATGAATCTTGG + Intergenic
1120935105 14:89888141-89888163 AGGTTTTAACATATGCATTTGGG - Intronic
1120991332 14:90380114-90380136 AAGTTCTAACATATGAATTTTGG - Intergenic
1121069655 14:91006367-91006389 GGATTTTAACATATGAATTTTGG - Intronic
1121138578 14:91521038-91521060 GGGTTGCAACATATGAAATTTGG - Intergenic
1121177885 14:91904797-91904819 GGGCTTCAACATATGGATTTGGG + Intronic
1121462121 14:94088611-94088633 GGGTTTTGACACAGGGAATTAGG - Intronic
1121694235 14:95899830-95899852 AGATTTCAACATATGAATTTTGG + Intergenic
1121757962 14:96419059-96419081 AGGTTTTAACATAGTTATTTTGG + Intronic
1121818522 14:96946487-96946509 GGATTTCAACATATGGATTTTGG + Intergenic
1121881115 14:97500980-97501002 GGGGTTTAACATATGGATTTGGG + Intergenic
1121941803 14:98077855-98077877 AGATTTCAACATATGAATTTTGG + Intergenic
1121979243 14:98439955-98439977 AAGTTTCAACATCTGGATTTTGG - Intergenic
1121986131 14:98508008-98508030 AGGTTTCAACATATGGGTTTAGG - Intergenic
1122085940 14:99304916-99304938 AGGCTTCAACATATGAATTTAGG + Intergenic
1123672259 15:22670940-22670962 AGGCTTCAACATATGCATTTTGG + Intergenic
1123912005 15:24977337-24977359 AGTTTTTAAAATATGGGAATAGG + Intronic
1124001509 15:25764324-25764346 AAGTTTTAACATATACATTTTGG - Intronic
1124085170 15:26542769-26542791 AGGTTTTAACCTAGTGAAATGGG + Intergenic
1124324306 15:28744231-28744253 AGGCTTCAACATATGCATTTTGG + Intergenic
1124528190 15:30477272-30477294 AGGCTTCAACATATGCATTTTGG + Intergenic
1124671237 15:31642301-31642323 AGATTTTAGCAAATCGAATTTGG - Intronic
1124770467 15:32530432-32530454 AGGCTTCAACATATGCATTTTGG - Intergenic
1125120695 15:36155389-36155411 GGGTTTCAACATATGAATTTTGG + Intergenic
1125124649 15:36206153-36206175 AGGATTTAACATATGAATTTTGG - Intergenic
1125215174 15:37263896-37263918 AGGTTTCAACGTATGAATTTGGG - Intergenic
1125291948 15:38158875-38158897 AGTTTTCAACATATGAACTTTGG - Intergenic
1126204999 15:46035441-46035463 GGGCTTCAACATATGGAACTGGG - Intergenic
1126212783 15:46118596-46118618 AGGGTTTAACAAATTGGATTAGG + Intergenic
1126222451 15:46230091-46230113 AGTTTTTAACAAATGGCATAGGG + Intergenic
1126372796 15:47964848-47964870 ATATTTTAACATATAGATTTGGG + Intergenic
1126910930 15:53416194-53416216 AGGTTTTAACATATAGATTCTGG - Intergenic
1126918437 15:53492271-53492293 AGGTTTCAACATATGAGTTTTGG + Intergenic
1127035752 15:54915713-54915735 TGGTTTTAAGATATGAGATTTGG - Intergenic
1127044662 15:55012995-55013017 AGGATTTCACAAATGTAATTAGG - Intergenic
1127564096 15:60169554-60169576 AAGTTTCAACATATGAATTTTGG + Intergenic
1127733781 15:61823134-61823156 ATGTTTTCACATATGAATTTTGG - Intergenic
1127815232 15:62602811-62602833 AGGTTTCAGCATATGAATTTTGG + Intronic
1128301600 15:66569620-66569642 AAGTTTCAACATATGAAATTCGG - Intergenic
1128643657 15:69359245-69359267 AGGTTTTGACACATGAATTTTGG + Intronic
1128704910 15:69831879-69831901 AGGTTTCAACATATGTATTTTGG + Intergenic
1128954009 15:71920319-71920341 AGGTTTCAATATATGAATTTTGG - Intronic
1128954260 15:71923179-71923201 ATGGTTTAACATATGCAAATCGG - Intronic
1129081271 15:73043160-73043182 AGGTTTCAACATATGAATTTTGG + Intergenic
1129380311 15:75160881-75160903 AGGTTTCAACATATGAATTTTGG + Intergenic
1129648215 15:77458161-77458183 AGGTTTTAACAAATGGGATGTGG - Intronic
1129820186 15:78595713-78595735 AGGTTTCAACATATGAATTGGGG - Exonic
1130114872 15:80998015-80998037 AAGTTTTAACATATGAATTTGGG + Intergenic
1130318335 15:82816194-82816216 AGGCTTCAACATATGCATTTTGG + Intronic
1130845708 15:87743221-87743243 AGGTTTCAACATACGAATTTTGG - Intergenic
1131361704 15:91797768-91797790 AGTTTTTAACACATGAACTTTGG + Intergenic
1131428485 15:92367022-92367044 AGGTTTCAACATATGAATTTTGG + Intergenic
1131600406 15:93841968-93841990 AGGTTATAAGAGATGGAATTGGG - Intergenic
1131659993 15:94503975-94503997 AGGTTTCAACATATGAATTCTGG + Intergenic
1132025230 15:98399490-98399512 AGGTCTCAACATATGAATTTTGG - Intergenic
1132800067 16:1747639-1747661 ATCTATTAACATATGGATTTGGG + Intronic
1132990553 16:2790622-2790644 AGGCTTTGACATATGAATTTTGG + Intergenic
1133131789 16:3680670-3680692 AGGTCTTAATATATGGATTTGGG - Intronic
1133413807 16:5590306-5590328 AGATTTTAACATCTGGGAATAGG + Intergenic
1133760008 16:8791076-8791098 AGGTTTCAACATATGAATTTGGG - Intronic
1133830244 16:9316339-9316361 AGGTTTTAAAATATGAATTTTGG + Intergenic
1133912603 16:10079455-10079477 AGGTTTTAACATCTGAATTTTGG - Intronic
1134768495 16:16783399-16783421 GGGTTTTAACATATGAATTTTGG - Intergenic
1134836321 16:17364101-17364123 GGGTTTCAACATATGAAATTAGG + Intronic
1134894321 16:17871152-17871174 AGGTTTCAACATATGAATCTAGG + Intergenic
1135309856 16:21396902-21396924 AAGTTTTAACATATGAATCTTGG + Intergenic
1135331307 16:21562444-21562466 AGGCTTCAACATATGAATTTGGG - Intergenic
1135362749 16:21829002-21829024 AAGTTTTAACATATGAATCTTGG + Intergenic
1135835096 16:25818177-25818199 AAATTTCAACATATGGATTTTGG - Intronic
1136007132 16:27338574-27338596 AAGTTTCAACATATGAATTTGGG - Intronic
1136132871 16:28234982-28235004 AGGTTTTAACATGTGAATTTTGG + Intergenic
1136149437 16:28337224-28337246 AAGTTTTAACATATGAATCTTGG + Intergenic
1136283616 16:29228846-29228868 AGGCTTTAACACATGTAATGAGG - Intergenic
1136306601 16:29376026-29376048 AAGTTTTAACATATGAATCTTGG + Intergenic
1136927892 16:34391473-34391495 AGGTTTCAACATATGAATTTTGG - Intergenic
1136976682 16:35020333-35020355 AGGTTTCAACATATGAATTTTGG + Intergenic
1137011636 16:35327473-35327495 AGGTGTCAACATATGAATTTTGG - Intergenic
1137045861 16:35660270-35660292 AGTTTTTATCACATGAAATTTGG - Intergenic
1137256159 16:46777310-46777332 AGGTTTTAAAATGTGCAAGTAGG - Intronic
1137283533 16:46998041-46998063 AGGTTTCAACATATGAGTTTGGG + Intergenic
1137292685 16:47062615-47062637 AGGTTTCAACATATTAATTTGGG - Intergenic
1137406666 16:48194532-48194554 TGGTTTCAACATATGAATTTTGG - Intronic
1137503298 16:49028308-49028330 GGGTTTCAACATATGAACTTTGG - Intergenic
1137699343 16:50485242-50485264 AGATTTTAACATATGAATTTTGG - Intergenic
1137823724 16:51470250-51470272 AGGTTTTAAAATTTGAAATCTGG - Intergenic
1138007521 16:53351727-53351749 AAGTTTTAACACATGAATTTTGG + Intergenic
1138310386 16:56018643-56018665 AGGTTTCAGCATATGAATTTGGG - Intergenic
1138709608 16:58955232-58955254 AGGTTTCAACATATGAATTTTGG + Intergenic
1138816854 16:60212509-60212531 AGGTTTCAACATATGGATTTTGG - Intergenic
1138874325 16:60930754-60930776 AGGTTTCAACATATGAATTTGGG - Intergenic
1138940148 16:61780497-61780519 AGATTTAAACAAATGAAATTAGG - Intronic
1139336369 16:66234575-66234597 AGTTTTCAACATATGAATTTTGG - Intergenic
1139622489 16:68157417-68157439 AGTTTATAATATATGGAATAGGG + Intronic
1140008039 16:71099263-71099285 AGATTTCAACATATGAATTTGGG - Intronic
1140211626 16:72975131-72975153 GGGTTTTAAGCTTTGGAATTTGG - Intronic
1140650411 16:77082046-77082068 GGGTTTCAACATATGAATTTTGG + Intergenic
1140706201 16:77632717-77632739 AGGTTTCAAAATATGAATTTGGG + Intergenic
1141042401 16:80683633-80683655 AGGTTTCTTCATATGAAATTTGG - Intronic
1141062604 16:80887898-80887920 AGGCTTCAACATATGAATTTGGG + Intergenic
1141201666 16:81903111-81903133 AGGTTTCAACATATAAATTTTGG + Intronic
1142088649 16:88198357-88198379 AGGCTTTAACACATGTAATGAGG - Intergenic
1142926632 17:3244892-3244914 AGGCTTTAACATTTTTAATTTGG + Intergenic
1143277632 17:5723529-5723551 TGGTTTCAACATATGAATTTTGG + Intergenic
1143282055 17:5762171-5762193 AAGCTTCAACATATGGATTTTGG - Intergenic
1143311297 17:5991689-5991711 GGGTTTTAACGTCTGGAAATGGG + Intronic
1143644043 17:8218134-8218156 AAGCTTTATCATATGGATTTTGG - Intergenic
1143690023 17:8553846-8553868 AAGTTTTATCATCTGGATTTTGG + Intronic
1143715111 17:8762037-8762059 GGGTTTCAACATATGAATTTTGG - Intergenic
1143816940 17:9524550-9524572 AGGTTCTAACATATGAATCTTGG + Intronic
1143908138 17:10226201-10226223 AGGTTTCAACACATGAATTTTGG + Intergenic
1143916442 17:10296872-10296894 AGAAGTTAACATATGGAGTTGGG - Intergenic
1144246010 17:13365615-13365637 AGGTATTATAATGTGGAATTTGG - Intergenic
1144279511 17:13711009-13711031 AGGTTTCAACATGTGAATTTAGG - Intergenic
1146098149 17:29952327-29952349 AGGTTCCAACATATGAATTTTGG + Intronic
1146840169 17:36146524-36146546 TGGTTTCAACATATGAATTTGGG + Intergenic
1147462157 17:40580025-40580047 GGGCTTTAACATATGCATTTAGG + Intergenic
1147639578 17:41987545-41987567 ACTTTTTAACAAAAGGAATTTGG + Intronic
1148478429 17:47944386-47944408 AGGCTTTAACATAGGGGTTTGGG + Intronic
1148538639 17:48462026-48462048 AGGATTTAATATATGAATTTGGG + Intergenic
1148635265 17:49144273-49144295 AGTTTCTAACACATGAAATTTGG + Intronic
1149067226 17:52495117-52495139 AGGCATTAATATATGGAATGTGG + Intergenic
1149270469 17:54971572-54971594 GGGCTTCAACATATGGATTTTGG + Intronic
1149286044 17:55165672-55165694 AGGTTTCAATATATGAAATTAGG - Intergenic
1149384902 17:56132906-56132928 AGGTTTTAAGACATGAATTTTGG + Intronic
1149589250 17:57816339-57816361 AGGTTTCAACATATAAATTTTGG + Intergenic
1149632485 17:58138031-58138053 AGGTTTCGACATATGAATTTAGG + Intergenic
1149632686 17:58139896-58139918 AGTTTCTAACACATGAAATTAGG + Intergenic
1149700735 17:58653440-58653462 AGTTTTTAACATATAAATTTTGG - Intronic
1149795567 17:59516121-59516143 AGGTTTTAGAATCTGGAATCTGG + Intergenic
1150033567 17:61768346-61768368 AAGTATTAGTATATGGAATTAGG + Intronic
1150036690 17:61808275-61808297 AAGTTTTAAAGTATGGGATTTGG - Intronic
1150202131 17:63368724-63368746 AGTTTTTAACTTATGGGAATTGG - Intronic
1150238191 17:63610209-63610231 TGATTTTAAGATGTGGAATTGGG - Intergenic
1150451077 17:65269605-65269627 AGGTTTCAACATATGAATTCTGG + Intergenic
1150478148 17:65489339-65489361 AGGTTCCAACATATGAATTTGGG + Intergenic
1150656219 17:67041557-67041579 AGGCTTCAACATATGAACTTGGG + Intergenic
1150835472 17:68559980-68560002 AGGTTTCAACATATGAATTTAGG - Intronic
1150870404 17:68903031-68903053 ACGGTTTAACATCTTGAATTTGG - Intronic
1150907330 17:69351842-69351864 AGATTTTAACATATGAATTTTGG - Intergenic
1150925059 17:69524141-69524163 AGGTTTTAACCTGTGGATTTTGG + Intronic
1150997831 17:70339623-70339645 AGGTTTCAACATATGAATTTTGG - Intergenic
1151229662 17:72675149-72675171 AGGTTTCACAATATGAAATTTGG - Intronic
1151234590 17:72710346-72710368 TGGTTTCAACATATGAATTTTGG - Intronic
1151485640 17:74397670-74397692 AAGTTTCAACATATGAATTTAGG - Intergenic
1151643649 17:75414800-75414822 GGGCTTCAACATATGGATTTTGG - Intergenic
1151983930 17:77529857-77529879 GGGATTTAATATATGGATTTGGG - Intergenic
1152102631 17:78311518-78311540 GGATTTTAACATAAGGAATCAGG + Intergenic
1203163781 17_GL000205v2_random:75562-75584 AATTTGTAACATATGGCATTGGG - Intergenic
1153066595 18:1052205-1052227 AGATTTTAATACATGGAATTAGG - Intergenic
1153176469 18:2379219-2379241 GGGCTTCAACATATGGCATTAGG + Intergenic
1153275912 18:3367670-3367692 AGATTTCAACATATGAATTTTGG + Intergenic
1153391693 18:4569048-4569070 AAGCTTTAACATATGAATTTTGG + Intergenic
1153585329 18:6614893-6614915 AGGTTTCAATATATGAATTTTGG + Intergenic
1153653120 18:7259142-7259164 AGGTTCCAACATGTGGATTTTGG - Intergenic
1153859115 18:9181954-9181976 AGGATTTAATGTAGGGAATTAGG + Intronic
1154053543 18:10988022-10988044 AAGTTTCAACATATGAATTTTGG - Intronic
1154213390 18:12398288-12398310 AGGCTTTGACATATGAAATTGGG - Intergenic
1155387594 18:25296512-25296534 AGATTTTAACCTGTGGAAATTGG + Intronic
1155437941 18:25832648-25832670 AGGTTTCAACATATGAATTTTGG - Intergenic
1155518160 18:26643353-26643375 GGGTTTCAACATATGAAATTCGG + Intronic
1155606000 18:27606591-27606613 AGGTTTCAACATATGAATTTCGG + Intergenic
1155619942 18:27767227-27767249 AGATTTTAACATATATATTTGGG + Intergenic
1155747875 18:29383442-29383464 GGGTTTCAACATATGAATTTCGG - Intergenic
1155751739 18:29432417-29432439 AAGTTTTATTATATGGGATTTGG - Intergenic
1156071994 18:33222640-33222662 ATGTTTCAACATATGAATTTTGG + Intronic
1156282023 18:35648576-35648598 AGGTTTTAACTTATGTGGTTGGG + Intronic
1156440527 18:37182753-37182775 ATATTTTCACATAAGGAATTGGG - Intronic
1156481269 18:37437861-37437883 AGGTTTCAACATAAGAATTTGGG - Intronic
1156534530 18:37849866-37849888 AGGTTGTAACTTATAGAATTGGG + Intergenic
1156584784 18:38420191-38420213 AGGTTTCAAGATATGAATTTTGG - Intergenic
1156733771 18:40228380-40228402 ACATTTTAAAAAATGGAATTTGG - Intergenic
1156816381 18:41316621-41316643 GAGTTTTAAAATATGGAAATTGG + Intergenic
1156867437 18:41904565-41904587 AGATTTTAACATACGAATTTTGG - Intergenic
1156894487 18:42229827-42229849 AGTTTTCAACACATGAAATTTGG + Intergenic
1157154445 18:45251819-45251841 AGGCTTCAACATATGAATTTTGG + Intronic
1157301726 18:46484295-46484317 AGGTTTCAACATATAAATTTGGG - Intronic
1157416310 18:47506291-47506313 AGGTTTCAACATATAGATTTTGG - Intergenic
1157852155 18:51065125-51065147 ATTTTTTAAAATCTGGAATTTGG - Intronic
1157869761 18:51219093-51219115 AGGCTTCAACATATGAAATTGGG + Intergenic
1157897452 18:51482674-51482696 AGGTTTCAACAGAGGGATTTTGG - Intergenic
1157901725 18:51524422-51524444 GGGCTTTAACATATGAATTTTGG + Intergenic
1158068031 18:53437064-53437086 AGGTTTCAACATAAGAATTTTGG + Intronic
1158241256 18:55380555-55380577 AGGTTTCAACATATGAATTTGGG + Intronic
1158299541 18:56035809-56035831 AGATTTCAACATATGAATTTAGG + Intergenic
1158399248 18:57106007-57106029 GGGTTTTAACGTATGAATTTTGG + Intergenic
1158400376 18:57116345-57116367 AAGTTTCAACAGATGGATTTGGG + Intergenic
1158703093 18:59766808-59766830 AGGTTTCAACATATGAATTTTGG - Intergenic
1158798818 18:60881122-60881144 AGGCTTGAACATATGAATTTAGG + Intergenic
1158870587 18:61683790-61683812 GGGTTTGAACATATGAATTTGGG - Intergenic
1158887853 18:61845858-61845880 AGGTTTCAACATATGCATTTTGG - Intronic
1158893814 18:61895076-61895098 AGGTTTTAAGGTGTGGAATAGGG - Intergenic
1158903069 18:61984281-61984303 AGGTTTTAACATATGAATTTTGG + Intergenic
1158939870 18:62397487-62397509 AGGTTTCAAAATATGAATTTGGG + Intergenic
1158948094 18:62465116-62465138 TGGTTTCAACATATGAATTTTGG + Intergenic
1159098057 18:63927667-63927689 AGGTTCCAACATATGAATTTTGG + Intronic
1159232666 18:65629313-65629335 AGGTTTCAAAATATGAATTTTGG - Intergenic
1159238132 18:65704397-65704419 AGGTTTTAAAAAATAGAATGAGG + Intergenic
1159460582 18:68717839-68717861 AAGTTTCAACATATGAAATTTGG - Intronic
1159534903 18:69703779-69703801 GGGTTTCAACATATGAATTTTGG - Intronic
1159544078 18:69817722-69817744 AGGCTTCAACATATGCATTTTGG + Intronic
1159560460 18:69987194-69987216 AGGCTTCAACATATGAATTTCGG + Intergenic
1159713259 18:71790288-71790310 AGGTTTAAACATATGTATTTTGG - Intergenic
1159858672 18:73619350-73619372 AGGTTTCAACATATGAATTTGGG + Intergenic
1160144927 18:76356060-76356082 AGGTTTCAACGTATGAAATTCGG - Intergenic
1160382460 18:78471067-78471089 AGGTTTCAACATATGGATTTCGG - Intergenic
1160552823 18:79706024-79706046 GGGTTTTAACACATGGACTTGGG - Intronic
1161237660 19:3205898-3205920 ATGTTTTAAAATGTGGACTTTGG - Intronic
1161813456 19:6484357-6484379 AGGTTTCAACATACGAATTTTGG - Intergenic
1162674932 19:12292025-12292047 AGTTTTTAAAAAATGGAATAGGG + Intronic
1163225862 19:15960716-15960738 GGATTTCAACATATGGATTTTGG + Intergenic
1163338270 19:16687792-16687814 AGGTTTCAACATATGAATTTGGG + Intronic
1164167465 19:22694768-22694790 AGGTATTAACATACTGAATAGGG - Intergenic
1164464431 19:28475542-28475564 AGGTTTCAACCTATGAATTTTGG - Intergenic
1164760864 19:30727325-30727347 AGGTTTCAACATATGAATTTGGG + Intergenic
1164852070 19:31492279-31492301 AGGTTTCAACACATGAATTTTGG + Intergenic
1165139924 19:33692801-33692823 ATGTTTTATCATAGCGAATTTGG + Intronic
1165267411 19:34672698-34672720 AGGTTTCAACATAGGAATTTTGG - Intronic
1165642032 19:37397855-37397877 AGATTTTAACCTATGAATTTTGG + Intergenic
1165642319 19:37400120-37400142 AGGTTTTAACCTAGGAATTTTGG + Intergenic
1165974507 19:39663438-39663460 TGGTCTTAAAATATGGAAATTGG + Intergenic
1166418656 19:42615802-42615824 AGGTTTTACAAGAAGGAATTTGG - Intronic
1166715449 19:44964205-44964227 AGACTTTAACATATGAATTTTGG + Intronic
1167246847 19:48378385-48378407 AGGTTTTAAAATGTGAAATCAGG + Intergenic
925400719 2:3570367-3570389 AGGATTTAACATGTGCACTTTGG - Intergenic
925515656 2:4678031-4678053 AGGTTTTAACATATGAATTTTGG + Intergenic
925550612 2:5069970-5069992 GGGTTTCAACATATGAATTTTGG + Intergenic
925694357 2:6560104-6560126 AGGTTTTTAAATATGGAATGTGG + Intergenic
925710242 2:6731968-6731990 AAGTTTCAACATATGAATTTGGG - Intergenic
925715341 2:6779750-6779772 GGGTTTTAATATATGAAGTTTGG + Intergenic
925786947 2:7441036-7441058 ATGTTTTATCATAAGAAATTTGG - Intergenic
926041725 2:9679081-9679103 AGATTTCAACATATGAATTTTGG - Intergenic
926052811 2:9755600-9755622 GGGCTTCAACATATGGATTTTGG - Intergenic
926352471 2:12008792-12008814 AGGCTTTGACATATGAATTTTGG + Intergenic
926375026 2:12218830-12218852 AGGATTTAACATATGAATTTGGG - Intergenic
926427575 2:12753387-12753409 AGATTTCAACATATGCATTTTGG - Intergenic
926564413 2:14454053-14454075 AGGTTTCAACATATGAATTTTGG + Intergenic
926582578 2:14647496-14647518 GGATTTCAACATATGGATTTGGG - Intronic
926632469 2:15149073-15149095 AGTTTCTAACATATGGACTTTGG - Intergenic
926666318 2:15527680-15527702 AAGTTTTAATACATGGATTTTGG + Intronic
926908503 2:17828196-17828218 AAGGTTTAACATATGAATTTTGG - Intergenic
927084704 2:19662911-19662933 AGGTTTCAATATATGAATTTTGG + Intergenic
927227967 2:20789178-20789200 AGGGTTTCACCTATGGATTTGGG - Intronic
928035570 2:27819415-27819437 AGGCTTCAACATATGAATTTTGG + Intronic
928439990 2:31284400-31284422 AGGTTTCAACATATGAATTCTGG - Intergenic
928538621 2:32263512-32263534 GGGCTTCAACATATGGATTTGGG - Intronic
928825869 2:35420447-35420469 AAGTTTTAATATATGAATTTGGG - Intergenic
929408662 2:41671828-41671850 AGGCTTCAACATATGAATTTTGG + Intergenic
929439869 2:41956858-41956880 GGGTTTCAACATATGAATTTCGG - Intergenic
929477547 2:42267019-42267041 ATGTTTAAACACATGGATTTTGG + Intronic
929783827 2:44975005-44975027 AGGTTTCAACAGATGAAATTGGG - Intergenic
929985815 2:46731148-46731170 AGGTTTCAACATATGAATTTTGG - Intronic
930170656 2:48247917-48247939 AGCATTTAAAATAGGGAATTGGG - Intergenic
930237037 2:48898387-48898409 AGATTTCAACATATGAAATTTGG - Intergenic
930334583 2:50029006-50029028 AGGTTTCAACATATGAATTTGGG - Intronic
930582604 2:53230035-53230057 AGGTTTCAACATATGAATTTTGG + Intergenic
930585385 2:53261748-53261770 AGCCTGTAACATATGGCATTGGG - Intergenic
930657138 2:54017563-54017585 AAGTTTCAACATATGAATTTTGG + Intronic
930683899 2:54287397-54287419 AAATTTTACCATATGAAATTTGG + Intronic
930862443 2:56089014-56089036 AGGTTTTAACATGTTGAAATTGG - Intergenic
930869736 2:56158348-56158370 GGGCTTCAACATATGGATTTGGG + Intergenic
931019969 2:58033033-58033055 AGGATTTAACATATGAATTTTGG + Intronic
931076910 2:58725530-58725552 AGATTTTGACATATGAATTTGGG - Intergenic
931117323 2:59179007-59179029 AGGTTTCAACATGTGAACTTTGG + Intergenic
931373059 2:61682113-61682135 AGGATTCAACATATGAATTTGGG - Intergenic
931939778 2:67239457-67239479 GGGCTTCAACATATGGATTTTGG - Intergenic
932071199 2:68622188-68622210 GGGTTTCAACATATGAATTTTGG - Intronic
932118615 2:69077556-69077578 AGGCTTTGAGAGATGGAATTGGG - Intronic
932136011 2:69229163-69229185 AGGCTTCAACACATGGATTTGGG + Intronic
932206398 2:69887125-69887147 AGGTTTCAACATACGAATTTTGG + Intergenic
932269086 2:70393260-70393282 AGGTTTCAACATATGGATTTTGG - Intergenic
932292299 2:70592803-70592825 GGGATTTAATATAAGGAATTAGG + Intergenic
932368486 2:71168353-71168375 AAGTTTTAACACATGAATTTTGG - Intergenic
933082959 2:78016376-78016398 TGATTTTAACATATGAATTTGGG + Intergenic
933184837 2:79267522-79267544 AGGTTTTAACATATGAATTTTGG + Intronic
933193814 2:79366976-79366998 GGGTTTAAACATATGAATTTGGG - Intronic
933195987 2:79390672-79390694 TGGTTTTCACATATGGAAATAGG + Intronic
933244707 2:79962419-79962441 AGGTTTTAACATATGAATTTTGG + Intronic
933281403 2:80336349-80336371 GGGTTTTAACATATGAATTTAGG + Intronic
933293783 2:80467670-80467692 AGGTTTCAACACATGCATTTTGG - Intronic
933479883 2:82842591-82842613 AGTTTTGATCATATAGAATTTGG - Intergenic
933553473 2:83804432-83804454 ATATTTAGACATATGGAATTAGG + Intergenic
933781040 2:85801432-85801454 AGGTTTCAACATATGAATTTTGG - Intergenic
934021431 2:87957667-87957689 GGATTTTAACATATGAATTTTGG + Intergenic
934126708 2:88900643-88900665 AGATTTCAACATATGAATTTTGG - Intergenic
934177951 2:89593837-89593859 AAGTTTCCACATATGAAATTTGG - Intergenic
934288249 2:91668138-91668160 AAGTTTCCACATATGAAATTTGG - Intergenic
934945843 2:98540846-98540868 AGTTTCTAACATATGAACTTTGG + Intronic
935233868 2:101121663-101121685 CTGTTTCAACATATGGATTTGGG + Intronic
935240691 2:101175538-101175560 AGGTTTCAACATATGAATTTTGG - Intronic
935337441 2:102029815-102029837 GGGTTTCAACATATGAATTTTGG + Intergenic
935366781 2:102301537-102301559 TTTTTTTCACATATGGAATTTGG + Intergenic
935429541 2:102960311-102960333 AAGTTTCAACACATGGATTTTGG + Intergenic
935581928 2:104763307-104763329 AGGCTTCAACATATAAAATTTGG - Intergenic
935717667 2:105953145-105953167 AGGTTTCAGCATATGGATTTAGG - Intergenic
935915929 2:107949191-107949213 AGGTTTCAACATATGAATTTGGG + Intergenic
936241129 2:110789702-110789724 GGGCTTTAACATATGAATTTTGG + Intronic
936341866 2:111640846-111640868 AGACTTCAACATATGGATTTGGG + Intergenic
936470837 2:112797424-112797446 AGGTTTTAACATATGAATTTTGG + Intergenic
936552480 2:113458729-113458751 CTTTTTTAACATATGAAATTGGG - Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936930603 2:117784733-117784755 AGGTTTTAACATATGAATTTTGG - Intergenic
937064988 2:119011125-119011147 AGGTTGTACTATATGGAGTTCGG - Intergenic
937199977 2:120195667-120195689 AGCTTTCAACATATGAATTTGGG - Intergenic
937509560 2:122578743-122578765 AGGGTTTAACATATGAATTGTGG - Intergenic
937570313 2:123350008-123350030 AGGGTTTAACATCTGGATGTTGG - Intergenic
937588646 2:123587530-123587552 GGGTTTTAACATATGAATTTTGG + Intergenic
937848704 2:126612506-126612528 AGGATTTAATAAATGGTATTGGG - Intergenic
937889085 2:126922119-126922141 GGGTTTTAATATATGAATTTTGG - Intergenic
938131693 2:128721352-128721374 GGGTTTTGGCATATGGATTTGGG + Intergenic
938586434 2:132695168-132695190 AGGTTTCAACATATGAATTGTGG + Intronic
938737787 2:134202215-134202237 AGATTTCAACATATGAATTTTGG - Intronic
938775508 2:134538112-134538134 TGGTTTTAACATATAAATTTTGG - Intronic
939045060 2:137240076-137240098 AGGTTTCAACATATAGATTTTGG + Intronic
939105756 2:137946740-137946762 AGGTTTCAACATGTGAATTTTGG - Intergenic
939310264 2:140467277-140467299 AGGTGTCAACATATGAATTTTGG - Intronic
939370974 2:141299912-141299934 GGATTTCAACATATGAAATTTGG - Intronic
939392988 2:141592523-141592545 AGGTTTCAATATATGAAGTTGGG + Intronic
939496161 2:142930779-142930801 GGGCTTTAACATATGAATTTGGG + Intronic
939499386 2:142963636-142963658 AGGTTGTGACATATAAAATTGGG + Intronic
939593145 2:144091242-144091264 AGGTTTTACAATTTAGAATTAGG - Intronic
939607210 2:144267905-144267927 AGGCTTTAACATAGGAATTTTGG - Intronic
940048407 2:149434966-149434988 AGGCTTCAACATATGAATTTTGG - Intronic
940069494 2:149669736-149669758 AAGTTTCAACATATGAATTTTGG - Intergenic
940158086 2:150680519-150680541 AGAATTTAACATATGAATTTAGG + Intergenic
940260594 2:151775927-151775949 ATGTTTCAACATATGAATTTGGG - Intergenic
940406963 2:153315444-153315466 AGGTTTAACCATATGAATTTTGG + Intergenic
940413416 2:153392784-153392806 AAGTTTTAACATATAAACTTTGG - Intergenic
940515298 2:154677043-154677065 AGTTTCTAACACATGAAATTTGG - Intergenic
940640170 2:156335919-156335941 CAGTTTTAACACATGGGATTAGG + Intronic
940718583 2:157257145-157257167 AGGTTTCAACATATGAATTTTGG + Intergenic
940722123 2:157293468-157293490 AGGTTTCAAAATATGAATTTTGG + Intronic
940734678 2:157437134-157437156 AGGCTTTAGCATATTGGATTGGG + Intronic
940859655 2:158758735-158758757 AGTTTCTAACACATGAAATTTGG - Intergenic
941233057 2:162935333-162935355 AAGTTTTAAAAAAAGGAATTTGG + Intergenic
941277885 2:163513687-163513709 AGATTTCAACATATGAATTTGGG + Intergenic
941310396 2:163921847-163921869 AGATTTCAACATATGAATTTGGG + Intergenic
941353895 2:164465639-164465661 AAGTTTCAACATATGAATTTTGG + Intergenic
941561280 2:167048076-167048098 AGGTTTTAACATATAAATTTTGG + Intronic
941879035 2:170462960-170462982 AGGTTGTACCACAGGGAATTAGG - Intronic
942174410 2:173318063-173318085 AGGTTCTAACATATGAACTTTGG + Intergenic
942216725 2:173728532-173728554 AGGGTTCAACATATGAATTTTGG - Intergenic
942373894 2:175315994-175316016 GAGATTTAACATAGGGAATTGGG - Intergenic
942516994 2:176764810-176764832 AGCTGTTAACTTATAGAATTGGG - Intergenic
943195603 2:184744344-184744366 GGGTTTCAACATATGAATTTTGG - Intronic
943313832 2:186360931-186360953 AGGTTTTAACATATGAATTTGGG - Intergenic
943328309 2:186528057-186528079 AGGTTTTAAAATCTGGAAGTGGG + Intergenic
943432580 2:187823398-187823420 AGGTTTCAACATGTGAATTTTGG - Intergenic
943487120 2:188499775-188499797 ATGTTTTAACATATGTAAATAGG - Intronic
943580929 2:189682933-189682955 AGGTTTCAACATTTGAATTTTGG - Intronic
943596033 2:189857787-189857809 AGTTTTAAATATAAGGAATTAGG + Intronic
943623021 2:190170269-190170291 GGGTTTCAACATATGAATTTGGG + Intronic
943823063 2:192352100-192352122 AGTTTCCAACATATGAAATTTGG + Intergenic
943882630 2:193166026-193166048 AAGGTTTTACATATGTAATTAGG - Intergenic
943898307 2:193397716-193397738 AGGCTTCAACATACGAAATTTGG + Intergenic
944127045 2:196305996-196306018 AGGTTTCAACATATGAACTCTGG - Intronic
944214775 2:197243854-197243876 AAGTTTCAACATATGAATTTTGG + Intronic
944294680 2:198048859-198048881 AAGTTTCAACATATGAATTTTGG + Intronic
944381098 2:199111796-199111818 AGGTTTCAACATATGGATTTTGG - Intergenic
944454251 2:199876844-199876866 AGGATTTAACATATGGTTTAAGG + Intergenic
944636506 2:201680536-201680558 AGGTCTCAACATATGAATTTTGG + Intronic
944783754 2:203046799-203046821 AGTTTACAACATATGAAATTTGG + Intronic
945195468 2:207233380-207233402 AGTTTTTAACATATGAATTTTGG - Intergenic
945683695 2:212943227-212943249 AGGTTTTATCCTATGGGCTTTGG - Intergenic
945763356 2:213942847-213942869 AGGCTTTAACATATGAGTTTTGG - Intronic
945772661 2:214063623-214063645 AGGTTTCAACATATGAATTTTGG + Intronic
945956487 2:216091169-216091191 AAATTTCAACATATGGATTTGGG - Intronic
946027887 2:216683014-216683036 TGTTTTTAAAATCTGGAATTTGG + Intronic
946481446 2:220060607-220060629 AGGTGTCAACATATGAATTTGGG - Intergenic
946521666 2:220471785-220471807 AGGTTTCAACATATGAATTTGGG - Intergenic
946550416 2:220795211-220795233 AAGTTTTAACACATGTATTTTGG - Intergenic
946667294 2:222064447-222064469 AGGTTTCAACATAGGAATTTCGG - Intergenic
946977743 2:225172561-225172583 GGATTTCAACATATGGATTTTGG - Intergenic
946996170 2:225394467-225394489 GGGTTTCAACATATGAATTTGGG - Intergenic
947005281 2:225504404-225504426 AGGTTTCAACACATGAATTTGGG + Intronic
947029462 2:225776626-225776648 AGATTTTAACATTTAGATTTTGG - Intergenic
947063765 2:226196711-226196733 AAGTTTTAAAATATGCATTTGGG + Intergenic
947313995 2:228835201-228835223 GGGTTTCAACATATGAATTTGGG - Intergenic
947883509 2:233543487-233543509 AGGTTTCAACGTATGAATTTTGG - Intronic
948281565 2:236751230-236751252 AGGTTTTAATGTATGAATTTTGG + Intergenic
948869372 2:240790556-240790578 AGGCTTCAAAATATGAAATTAGG - Intronic
1168865340 20:1081245-1081267 AGGTTTCAACATATGAATTTTGG - Intergenic
1168906198 20:1405648-1405670 GGGTTTTAGCATATGAATTTAGG + Intergenic
1168918010 20:1507315-1507337 AGGTGCTAACATGTGGATTTGGG - Intergenic
1169281242 20:4268560-4268582 AGGCTTCAACATATGCATTTTGG + Intergenic
1169296709 20:4406248-4406270 GGGTTTCAACATATGAATTTTGG + Intergenic
1169301301 20:4443983-4444005 AGGTTTTAACCTATGAATTTTGG + Intergenic
1169409939 20:5359774-5359796 AAGTTTCAACATATGAATTTTGG + Intergenic
1169633125 20:7656214-7656236 AGGTTTTAACATGATGTATTAGG - Intergenic
1170178422 20:13499217-13499239 AGGTGTGAACATGTGGTATTTGG - Intronic
1170342511 20:15345194-15345216 GGGTTTCAACATATGAATTTTGG + Intronic
1170349518 20:15423756-15423778 AGGTTTCAGCGTATGGATTTAGG + Intronic
1170409466 20:16072991-16073013 GGATTTTAACATATGAATTTTGG - Intergenic
1170547940 20:17450862-17450884 AGGTTCTAATATATGAATTTGGG + Intronic
1170602528 20:17851974-17851996 GGGTTTCAAGATATGGATTTTGG - Intergenic
1170714301 20:18818647-18818669 AGGTTTTGACATATGAATCTGGG - Intronic
1170796965 20:19556189-19556211 AGGTTTCAACATATAAATTTGGG + Intronic
1170842018 20:19931439-19931461 AGGTTTTAAAATATATTATTAGG - Intronic
1171089465 20:22270253-22270275 GGATTTCAACATATGAAATTTGG + Intergenic
1171319632 20:24230314-24230336 AGTTTTCTACATATGCAATTAGG - Intergenic
1171394825 20:24825252-24825274 AAGTTTCAACATATGAATTTTGG + Intergenic
1171437065 20:25131983-25132005 AGGTTCCAACATATGAATTTGGG + Intergenic
1172220043 20:33267690-33267712 AGGGTTCAACATATGAATTTGGG + Intergenic
1172555828 20:35840437-35840459 AGGATTTAACGTGGGGAATTGGG + Intronic
1172899718 20:38325630-38325652 GGGTTTCAACATATGAATTTGGG + Intronic
1172950172 20:38718359-38718381 GGGCTTCAACATATGGATTTGGG + Intergenic
1172999308 20:39094061-39094083 AGGGTTCAACATATGAATTTAGG - Intergenic
1173148125 20:40543083-40543105 GGATTTTAACATATGAATTTTGG - Intergenic
1173254539 20:41384829-41384851 GGACTTTAACATATGGATTTTGG + Intergenic
1173321662 20:41992703-41992725 AAGTTTCAACATATGAATTTTGG + Intergenic
1173364508 20:42372656-42372678 AGGTTTCAACGTATGAATTTGGG - Intronic
1173370184 20:42428120-42428142 AGGTTTTATCATAAGAATTTTGG + Intronic
1173435192 20:43026046-43026068 AGGATTTAGCATATGAATTTTGG - Intronic
1174729204 20:52898230-52898252 AGGTATTCACATTTGGAATCTGG - Intergenic
1174856719 20:54052491-54052513 AAGTTTCAACATATGAATTTTGG - Intronic
1174947256 20:55001946-55001968 AGGTTTAAAAATATTGTATTGGG - Intergenic
1175066528 20:56293768-56293790 GGATTTCAACATATGGATTTTGG - Intergenic
1175341774 20:58236017-58236039 AGCTTTTAAAATTTGAAATTAGG - Intergenic
1175564689 20:59963888-59963910 AGGTTTTAAGATAATGAAATTGG - Intronic
1175728373 20:61334683-61334705 GGGTTTCAACATATGGATTTGGG + Intronic
1176337825 21:5615405-5615427 AATTTGTAACATATGGCATTGGG + Intergenic
1176339233 21:5678478-5678500 AATTTGTAACATATGGCATTGGG + Intergenic
1176471487 21:7110631-7110653 AATTTGTAACATATGGCATTGGG + Intergenic
1176495048 21:7492409-7492431 AATTTGTAACATATGGCATTGGG + Intergenic
1176505594 21:7645978-7646000 AATTTGTAACATATGGCATTGGG - Intergenic
1176937661 21:14885183-14885205 GGGTTTCAACATATGAATTTTGG - Intergenic
1176963526 21:15186580-15186602 AGATTTAAACATTTGGATTTGGG + Intergenic
1177028063 21:15946640-15946662 AGGCTTTAACATTTTTAATTTGG - Intergenic
1177170005 21:17644572-17644594 AGGCTTCAACATATGAATTTTGG + Intergenic
1177285914 21:19049681-19049703 GGGTTTCAACATATGAAATTGGG - Intergenic
1177302850 21:19272287-19272309 TGGTTTTAACATATTAATTTTGG + Intergenic
1177394868 21:20520589-20520611 AGGTTTTAACGTATGAATTTTGG + Intergenic
1177502650 21:21978054-21978076 AGATTTCAACATATGAATTTTGG + Intergenic
1177530243 21:22349536-22349558 AAGTTTCAACATATGAAATTTGG - Intergenic
1177535282 21:22419399-22419421 AGGTTTCAACACATGAATTTTGG - Intergenic
1177630795 21:23724996-23725018 GGGTTTCAACATATGAACTTCGG + Intergenic
1177734526 21:25072603-25072625 AGGTTTCAACATATGAATCTGGG + Intergenic
1177734870 21:25076481-25076503 AGGTGATAACATGTGGTATTTGG - Intergenic
1177736982 21:25103401-25103423 AGCTTTCAACATATGAATTTTGG - Intergenic
1177749012 21:25256754-25256776 AGGTTTCAACAAATGAATTTGGG + Intergenic
1177752879 21:25308030-25308052 GGGTTTCAACATATGAATTTTGG - Intergenic
1177790045 21:25713168-25713190 AGGTTTCAACATATGAATTTTGG + Intronic
1177806418 21:25879428-25879450 GGGTTTCAACATAGGGATTTGGG - Intergenic
1177815713 21:25974349-25974371 AGGTTTCAACATATGAATTGGGG - Intronic
1177843005 21:26255541-26255563 AGGTTTCAACGTATGAATTTGGG + Intergenic
1177863563 21:26484721-26484743 AGCTGTTAAGATATCGAATTGGG + Intronic
1177996659 21:28108231-28108253 AGGTTTCAACATATACATTTGGG - Intergenic
1178044113 21:28674976-28674998 AGGTTTCAACATATGAATTCTGG + Intergenic
1178374105 21:32052101-32052123 AGGCTTTACCATATGAATTTTGG + Intergenic
1178435331 21:32553192-32553214 GGGTTTTAACATGTGAATTTTGG - Intergenic
1178574203 21:33770423-33770445 GGGCTTAAACATATGGATTTTGG + Intronic
1178839031 21:36123865-36123887 AGGTTTCAACATATAAATTTTGG - Intergenic
1178905775 21:36634698-36634720 GGATTTTAACATATGCATTTTGG + Intergenic
1179221200 21:39409008-39409030 CGGCTTCAACATATGAAATTTGG - Intronic
1179357814 21:40677634-40677656 AGGTTTCAACATATGAATTTTGG - Intronic
1179425235 21:41272863-41272885 AGGTTTCAACATAAGAATTTTGG - Intronic
1179560279 21:42211538-42211560 AGGTTCTAACATATGAATTTGGG - Intronic
1180608540 22:17080264-17080286 AGTTTGTAACATGTGAAATTTGG + Intergenic
1180608719 22:17081806-17081828 AGTTTCTAACATGTGAAATTTGG + Intergenic
1180748402 22:18108203-18108225 AGGCTTTAACACATGAATTTTGG + Intronic
1181389163 22:22567024-22567046 AGGTTTCAACATATGAATTTTGG + Intergenic
1181443048 22:22948089-22948111 AGGTTTCAACATATGAATTCTGG + Intergenic
1182108970 22:27709387-27709409 AGGTTTCAACATATGAATTTTGG + Intergenic
1182483561 22:30625864-30625886 AGGTTTTAACATATACATTTTGG + Intronic
1182802372 22:33041980-33042002 CGGTTTTAACATATGAATTTGGG - Intronic
1182960778 22:34472939-34472961 AAATTTTAACAGATGGAAATTGG + Intergenic
1183044311 22:35207565-35207587 AGGTTTCAATATATGAATTTTGG + Intergenic
1183681617 22:39333836-39333858 AGGTTTCAATATATGAATTTTGG - Intergenic
1184541258 22:45126844-45126866 AGGTTTCAACATATGAATTTGGG + Intergenic
1184750073 22:46480451-46480473 TGATTTTAAGATGTGGAATTGGG - Intronic
1185163894 22:49245888-49245910 AGGCTTTAACATGTGAACTTTGG + Intergenic
949122637 3:405126-405148 AGGTTTTAACATAGGAAGCTTGG + Intronic
949208197 3:1466083-1466105 AGGTTTCAACATATGAATTTTGG - Intergenic
949372997 3:3355207-3355229 AAGTTTCAACATATGGATTTTGG - Intergenic
949603247 3:5624814-5624836 AGGTTTCAACATATGAATTTGGG - Intergenic
949830788 3:8211929-8211951 AAGTTTTAACATCTGAATTTTGG + Intergenic
949833554 3:8243675-8243697 AGGTTTCAACATCTGAATTTGGG - Intergenic
949846894 3:8380733-8380755 GGGTTTCAACATATGAATTTGGG - Intergenic
950248654 3:11445439-11445461 AAGTGATAACATATGGTATTAGG - Intronic
950798871 3:15533245-15533267 AAGTTTCAACATATGAATTTGGG + Intergenic
950868391 3:16208096-16208118 ATGTTTTTCCATAAGGAATTAGG - Intronic
951061672 3:18215688-18215710 AGATTTTAACATATGAATTTGGG - Intronic
951108235 3:18770427-18770449 AGGTTTCAACATATAAATTTTGG + Intergenic
951163337 3:19453566-19453588 AGGTTTTGACATATCAATTTTGG - Intronic
951430467 3:22601199-22601221 AGGTTTCAATATATGGATTTTGG - Intergenic
951462093 3:22962603-22962625 AGATTTTAACATAGGAATTTTGG - Intergenic
951470973 3:23055610-23055632 AGGTTTCAACAGATGAATTTTGG + Intergenic
951527462 3:23667753-23667775 AGGTTTAAACACATGAATTTTGG - Intergenic
951690449 3:25390081-25390103 AAGTTTCAACATATGAATTTTGG - Intronic
951942173 3:28091701-28091723 AAGTTTCAACATATGAATTTTGG - Intergenic
952011440 3:28904668-28904690 AGTTTTCAACATATGAATTTTGG + Intergenic
952209692 3:31217205-31217227 ATTTTTTTACATCTGGAATTTGG - Intergenic
952213071 3:31248959-31248981 AGGTCTTCACATATGTGATTTGG + Intergenic
952329014 3:32346727-32346749 GGGGTTCAACATATGGATTTGGG + Intronic
952428496 3:33199698-33199720 AGGTTTCAACGTATGAATTTTGG - Intronic
952585291 3:34885610-34885632 CGGTTTTAACACATGAATTTTGG - Intergenic
952590623 3:34949119-34949141 AGGATTCAACATATGAACTTGGG + Intergenic
952597637 3:35037714-35037736 AGGTTTCAACATATAAATTTGGG + Intergenic
952671962 3:35980117-35980139 AGGTTTCAACACATGAATTTGGG + Intergenic
952935127 3:38391624-38391646 AGTTTTTAACATGTGAATTTGGG - Intronic
953204129 3:40806165-40806187 GGGTTTCAAGATATGGATTTTGG + Intergenic
953206993 3:40839883-40839905 AGGTTTCAACATATGCATTTCGG + Intergenic
953468758 3:43148805-43148827 AGGTTTCAACATATGAATTTTGG - Intergenic
953687569 3:45090112-45090134 AGGTTTTCACTTGTGGCATTTGG + Intronic
953719794 3:45345413-45345435 GGGCTTCAACATATGGATTTGGG + Intergenic
953955917 3:47231996-47232018 AGCTTTCAACATATGAATTTTGG - Intronic
954001539 3:47561220-47561242 GGGCTTCAACATATGGATTTTGG - Intergenic
954769430 3:52952801-52952823 AGGTTTCAACATATAAATTTTGG + Intronic
955294212 3:57720543-57720565 AGTTTTCAACATATGAATTTTGG + Intergenic
955930931 3:64056050-64056072 AGATTTCAACATATGAATTTTGG - Intergenic
956057492 3:65315654-65315676 AGGTATTAACTTATGAACTTTGG + Intergenic
956228481 3:66986480-66986502 GGGTTTCAACATATGAATTTGGG + Intergenic
956269669 3:67437682-67437704 AGTTTATAAAATATGGATTTAGG + Intronic
956367367 3:68519129-68519151 AGGTTTTAACATACGAATTGAGG - Intronic
956518006 3:70071770-70071792 AGGTTTTAACATTTGATAATAGG + Intergenic
956525127 3:70150567-70150589 AAATTTAAACATATGGTATTTGG - Intergenic
956689580 3:71863555-71863577 GGATTTTAACATATGAATTTTGG + Intergenic
956820129 3:72946734-72946756 AGATTTTAACATATGAACTTGGG + Intronic
956979644 3:74620938-74620960 AGATTTCAACATATGGATTTTGG + Intergenic
957020067 3:75116769-75116791 AGGATTCAACATATGAATTTTGG - Intergenic
957124785 3:76144728-76144750 GGGTTTTAACTTGTGGAATATGG + Intronic
957185467 3:76935945-76935967 AGGTTTCAACATAAGAATTTAGG + Intronic
957264240 3:77941333-77941355 GGATTTTAACATATGAATTTTGG - Intergenic
957300164 3:78381535-78381557 AAGTTTTAACACATGAATTTGGG - Intergenic
957854806 3:85860753-85860775 GGGTTTCCACATATGAAATTTGG + Intronic
957936568 3:86951494-86951516 AGATTTCAACATATGAATTTGGG + Intronic
958060814 3:88477446-88477468 AGGTTTTGACATATGCATTTTGG + Intergenic
958168346 3:89906180-89906202 AGCTTTTAACACATGAACTTTGG + Intergenic
958472357 3:94536881-94536903 AGGTTTCAACATATAAATTTGGG - Intergenic
958691810 3:97478872-97478894 ATTTTTTAATATTTGGAATTTGG - Intronic
958846489 3:99271194-99271216 AGGTTTTAACATATGAATATGGG - Intergenic
958891309 3:99786262-99786284 ATATTTTAACATATGAATTTGGG - Intronic
958950632 3:100411853-100411875 GGGCTTCAACATATGGATTTTGG + Intronic
959040360 3:101415176-101415198 TGATTTTAAGATGTGGAATTGGG + Intronic
959126852 3:102300234-102300256 AGGTTTTAACACATGAATTTTGG + Intronic
959164308 3:102758284-102758306 AAGTTTCAACATATGAATTTGGG - Intergenic
959193258 3:103142637-103142659 AAGTTTCAACATATGAATTTTGG - Intergenic
959246767 3:103880535-103880557 GGATTTTAACATATGAATTTTGG + Intergenic
959321557 3:104882447-104882469 TTGTTTTAACATCTGGAAATGGG - Intergenic
959321835 3:104886588-104886610 GGGTTTCAACATATGAATTTCGG - Intergenic
959332541 3:105023951-105023973 AGGTTTCAACATATGAATTTTGG - Intergenic
959349816 3:105248168-105248190 AGGTTTCAACATATAAATTTTGG - Intergenic
959417008 3:106087515-106087537 GGATTTTAACATATGAATTTAGG + Intergenic
959457266 3:106578287-106578309 AAGTTAGAACATATGGTATTTGG - Intergenic
959509241 3:107190727-107190749 AGGTTTCAACATACGAATTTGGG + Intergenic
959567979 3:107852358-107852380 AGGTTTCAACATATAAATTTGGG - Intergenic
959601077 3:108186353-108186375 AGGTTTCAAAATATGGATTTTGG + Intronic
959684567 3:109130415-109130437 GGGCTTTAACATATGAATTTGGG - Intergenic
959858604 3:111190737-111190759 AGGTTTCAACATATGAATTTTGG + Intronic
960230465 3:115220204-115220226 AGGTTTTAACTTATGAATTTTGG + Intergenic
960288471 3:115856205-115856227 AAGTTTCAACATATGAATTTTGG - Intronic
960617155 3:119606452-119606474 AGATTTCAACATATGAATTTTGG + Intronic
960848910 3:122031509-122031531 AGGTTTCAACATATGAATTTGGG - Intergenic
960895306 3:122498189-122498211 AGGATTTAACATATGAATTTTGG - Intronic
960898905 3:122534390-122534412 AGGTTTTACAACATGGAATAGGG + Intronic
960913733 3:122676322-122676344 AGGATTTAACATATGAATTTGGG + Intergenic
961026782 3:123565325-123565347 AGGTTTCAACATAGGAATTTTGG - Intronic
961111682 3:124289272-124289294 AGTTTTCAACACATGAAATTTGG + Intronic
961251891 3:125514141-125514163 AGGTTTCAACATATGAATTTTGG + Intronic
961580747 3:127879891-127879913 AGGGTTCAACATATGAATTTGGG + Intergenic
961843304 3:129737053-129737075 AGGTTCCAACATATGAATTTTGG - Intronic
962088225 3:132214258-132214280 AGATTTTAATATATGAAATTGGG - Intronic
962140707 3:132787799-132787821 AGATTTCAACATATGAACTTGGG - Intergenic
962164460 3:133034453-133034475 AGGTTTCAACATATGAATTTTGG + Intergenic
962185756 3:133258035-133258057 AGGTTTCAACATATGAATTTGGG - Intronic
962577790 3:136770636-136770658 AGGTTTCAACATATTAATTTTGG - Intergenic
962770500 3:138606841-138606863 AGGTTTCAACATATGAATTTTGG + Intergenic
962996935 3:140638667-140638689 AGTATTTAACATATGGGGTTAGG - Intergenic
963136150 3:141906623-141906645 TGGTTTTCACATACTGAATTTGG - Intronic
963207656 3:142652905-142652927 ACTTTTTAACACATGGGATTTGG - Intronic
963329503 3:143898513-143898535 AGGCTTAAACATATGAATTTTGG - Intergenic
963467910 3:145705426-145705448 AGGTTTCAACACATGAATTTGGG - Intergenic
963877905 3:150497451-150497473 GGGCTTTAACATATGAATTTTGG - Intergenic
964033743 3:152170053-152170075 AGATTTTAACATATGAATTTTGG + Intergenic
964307465 3:155356632-155356654 GGGTTTCAACATATGAATTTGGG - Intergenic
964309797 3:155380446-155380468 GGGCTTCAACATATGAAATTTGG - Intronic
964323788 3:155525252-155525274 AGGTTCTAATACATGGATTTTGG - Intronic
964492417 3:157250857-157250879 TGGTTTTAACATATAAATTTGGG + Intergenic
964703809 3:159597174-159597196 AGGTTGTAAAATATGAAATATGG + Intronic
964807555 3:160628071-160628093 GGGTTTCAACATATGAATTTGGG + Intergenic
964838493 3:160967616-160967638 AGTTTTCAACATATGAATTTTGG + Intronic
964913046 3:161805070-161805092 GCGTTTCAACATATGGATTTGGG + Intergenic
964915491 3:161836736-161836758 AGATTTTAACATATTAATTTGGG - Intergenic
964982036 3:162696568-162696590 ACGTTTCAACACATGAAATTTGG - Intergenic
965037412 3:163458739-163458761 GGGTTTCAACATATGAATTTGGG - Intergenic
965064102 3:163822974-163822996 TTATTTTGACATATGGAATTTGG + Intergenic
965072312 3:163930486-163930508 AGGTTTCAACATATAAATTTTGG - Intergenic
965195053 3:165584149-165584171 AAGTTTCAATATATGAAATTTGG + Intergenic
965279661 3:166733720-166733742 AGGTTTAAACATATCCATTTAGG + Intergenic
965364550 3:167782806-167782828 GGATTTGAACATATGGAACTTGG + Intronic
965378824 3:167961963-167961985 AGGTTTCAATATATGTATTTTGG + Intergenic
965430408 3:168580253-168580275 ATGCTTAAAAATATGGAATTTGG - Intergenic
965525122 3:169708227-169708249 AGGTTTCAACATATGAATTTTGG - Intergenic
965561922 3:170070072-170070094 AGGCTTCAACATATGAATTTGGG + Intronic
965835542 3:172847800-172847822 AAGTTTCAACATATGAATTTTGG - Intergenic
966077930 3:175961216-175961238 AGGTTTTAACATGTAAATTTTGG + Intergenic
966226674 3:177605379-177605401 AAGTTTCAACATATGAATTTTGG - Intergenic
966541666 3:181098216-181098238 AGGTTCTGACATATGAATTTGGG + Intergenic
966551450 3:181208891-181208913 AGATTTCAACATATGAATTTTGG + Intergenic
966752445 3:183335458-183335480 AGGTTTCAACATATGAATTTTGG - Intronic
966758910 3:183397522-183397544 AGGTTTCAACATATGAATTTTGG + Intronic
966793039 3:183690853-183690875 AGGTTTCAACATAGGAATTTTGG + Intergenic
967127980 3:186443008-186443030 AGGTTTCAACATATGAATTTTGG + Intergenic
967330971 3:188288947-188288969 AGATTTTAAAATATGGAGATTGG + Intronic
967769516 3:193319350-193319372 AGGCTTCAACATATGAATTTTGG - Intronic
967798288 3:193623279-193623301 AGGTTTCAACATATGAATTGTGG + Intronic
967822171 3:193848408-193848430 AGATTTCAATATATGAAATTTGG - Intergenic
967854501 3:194106540-194106562 GGGTTTCAACATATGAATTTAGG + Intergenic
967887577 3:194343626-194343648 AGATTTGAACTCATGGAATTAGG - Intronic
968029483 3:195471199-195471221 AGATTCTAACAGATGGGATTCGG - Intergenic
968206832 3:196809925-196809947 AGGTTTTAAAATTAGGAAGTTGG - Intronic
968333959 3:197896810-197896832 GGATTTCAACATATGGATTTGGG + Intronic
969128316 4:4971167-4971189 AAGTTTCAACATATAAAATTTGG - Intergenic
969528129 4:7714515-7714537 TGGTTCTAACAGATGGAATGAGG - Intronic
970027094 4:11635189-11635211 AGGCTTTAAAATATGAATTTGGG + Intergenic
970075747 4:12217561-12217583 TGATTTTAACATATGAATTTTGG + Intergenic
970237732 4:13975549-13975571 AGGTTTAAACGTATGAAGTTTGG + Intergenic
970260921 4:14223967-14223989 GGGTTTCAACATATGAATTTGGG - Intergenic
970271403 4:14351804-14351826 AGGTTTTGACATATAAATTTTGG + Intergenic
970284347 4:14493422-14493444 AGGTTTCAACATATGCATTTTGG - Intergenic
970314691 4:14817879-14817901 GGGTTTCAACATATGGATTTTGG + Intergenic
970559081 4:17265319-17265341 AGGTTGCAACATATGAATTTGGG + Intergenic
970599529 4:17630281-17630303 AGGTTCCAACATATGAATTTTGG - Exonic
970698374 4:18705085-18705107 AGTTTTCAACATATGAATTTTGG + Intergenic
970763572 4:19519213-19519235 AGATTTTAACATATTTATTTTGG + Intergenic
970778826 4:19710643-19710665 AGGTTTCAACATATGGATTTGGG - Intergenic
971109764 4:23572345-23572367 AGATTTCAACATCTGGACTTCGG - Intergenic
971159609 4:24120609-24120631 GGGTTTCAACATATGAATTTTGG - Intergenic
971190229 4:24421084-24421106 AGGTTTCAACATATACATTTTGG + Intergenic
971362835 4:25952909-25952931 GGGCTTCAACATATGGATTTTGG - Intergenic
971412713 4:26392081-26392103 AGGTTTCAACATAGGAATTTTGG + Intronic
971420753 4:26472028-26472050 GGGTTTCAACATATGAATTTGGG - Intergenic
971450772 4:26799520-26799542 AGGTTTTGACATATTAATTTTGG - Intergenic
971597649 4:28552203-28552225 AAGTTTCAACATATGAATTTTGG - Intergenic
971599597 4:28575457-28575479 ATGTTTCAACATATGAATTTGGG + Intergenic
971604133 4:28635480-28635502 AGGGTTGAAAAGATGGAATTTGG + Intergenic
971805376 4:31351685-31351707 GAGTTTCAACATATGGATTTGGG - Intergenic
971827530 4:31645691-31645713 GGATTTTAACATATGGATTTGGG - Intergenic
971909980 4:32783418-32783440 AGGTTTCAACATAAGAATTTGGG + Intergenic
971924307 4:32987105-32987127 GAGTTTTAACATATGAATTTTGG - Intergenic
972007822 4:34133459-34133481 AGGTTTCAACATATGAATTTTGG + Intergenic
972132299 4:35852733-35852755 AGGTTTGAACATATAAATTTGGG + Intergenic
972181354 4:36470666-36470688 AAGTTTTAACAAATGAATTTAGG - Intergenic
972181990 4:36478497-36478519 GGATTTTAACATATGAATTTGGG - Intergenic
972273434 4:37534838-37534860 ATGTTTCAACATATGGATTTTGG + Intronic
972295726 4:37736007-37736029 AGGTCTCAACATATGAATTTTGG - Intergenic
972662169 4:41126950-41126972 ACATTTTAACATATGAATTTTGG + Intronic
972674189 4:41243560-41243582 GGGATTTAATATAGGGAATTAGG + Intergenic
972790110 4:42363733-42363755 GGGTTTCAACATATGAATTTGGG - Intergenic
972833001 4:42835716-42835738 AGGTTCTAACATATGAATTTGGG - Intergenic
972973678 4:44607519-44607541 AGGTTTCAACATATGAATTTGGG + Intergenic
973037960 4:45431183-45431205 AAGTTTTAACAAATTGAGTTTGG + Intergenic
973073333 4:45893366-45893388 AAGTTTCAACATATGAATTTTGG + Intergenic
973154780 4:46937003-46937025 AGTTTTCAACATATGAATTTGGG - Intronic
973290230 4:48463741-48463763 AGATTTTAACATATGAATTTTGG + Intergenic
973580276 4:52337824-52337846 AGGGTTTCACATATGAATTTTGG - Intergenic
973770689 4:54203802-54203824 AAGTTTTGACATATGAATTTTGG + Intronic
973770953 4:54205967-54205989 AAGTTTTGACATATGAATTTTGG + Intronic
973849860 4:54950138-54950160 GGATTTTAACATATGAATTTGGG + Intergenic
973910709 4:55577308-55577330 AGGTTTCAACATATGAATTTGGG + Intronic
974096342 4:57368601-57368623 AGGTTTCAACCTATGGATTTTGG + Intergenic
974194209 4:58550721-58550743 AGGTTTCAACATAGGAATTTTGG - Intergenic
974297554 4:60021745-60021767 ATTTTTTGACATATGAAATTAGG + Intergenic
974389021 4:61240347-61240369 AGGTTCCAACATATGAATTTTGG + Intronic
974413094 4:61567342-61567364 AGTTTTCAACATATAAAATTGGG - Intronic
974457688 4:62148814-62148836 CGATTTTAACATATGAATTTTGG + Intergenic
974465054 4:62244494-62244516 AAGTTTCAACATATGAATTTTGG + Intergenic
974558373 4:63482477-63482499 AGGTTCTTACATATGAAAATGGG + Intergenic
975387298 4:73772315-73772337 AGACTTTAACATATGAATTTAGG - Intergenic
975704372 4:77097505-77097527 AGGCTTCAACATATGAATTTTGG - Intergenic
975912104 4:79279100-79279122 AGTTTCTAACATATGAATTTTGG + Intronic
975929232 4:79498240-79498262 AGGTTTCAGCATATGAATTTTGG + Intergenic
976039631 4:80867814-80867836 AGGTGTCAACATATGAATTTGGG + Intronic
976047429 4:80967747-80967769 AGTTTTCAACATATGAACTTTGG + Intergenic
976050108 4:81001608-81001630 AAGTTTCAACATATGAATTTTGG + Intergenic
976144350 4:82026889-82026911 GGATTTTAACATATGAATTTCGG - Intronic
976309848 4:83600414-83600436 GGGCTTTAACATATGAATTTTGG + Intronic
976577220 4:86687448-86687470 AAGATATAACATATAGAATTAGG + Intronic
976586800 4:86807316-86807338 AGTTTCTGACATATGAAATTTGG - Intronic
976683707 4:87786903-87786925 GGGTTTCAACATATGGATTTTGG - Intergenic
976746747 4:88410631-88410653 GGATTTTAACATATGAATTTTGG + Intronic
976806318 4:89051425-89051447 AGGTTTCAACATGTGAATTTTGG + Intronic
977038787 4:91987316-91987338 GGATTTTAACATATGAAAGTTGG + Intergenic
977191095 4:94001492-94001514 AGGGTTCAACATATGAATTTTGG + Intergenic
977401567 4:96539190-96539212 ATGTTTCAACATATGAATTTTGG - Intergenic
977437848 4:97022741-97022763 AGATTTCAACATATGAATTTTGG - Intergenic
977464718 4:97369494-97369516 AAGTTTAAACATATGAATTTGGG - Intronic
977691564 4:99917522-99917544 AGGTTTCAACATATGAACTTTGG + Intronic
977751629 4:100616644-100616666 GGGTTTCAACATATGAATTTGGG + Intronic
977876902 4:102160810-102160832 AGATTTTAACATATGAGTTTTGG - Intergenic
978005775 4:103614060-103614082 TGGCTTTAACATATGAATTTTGG + Intronic
978204432 4:106063650-106063672 AGATTTTAACATATGAATTTGGG - Intronic
978420381 4:108526387-108526409 AGGTTTTAGGATATGGGTTTTGG + Intergenic
978502920 4:109428257-109428279 GGGCTTCAACATATGGATTTTGG - Intergenic
978643197 4:110896092-110896114 AGATTTCAACATATGCATTTTGG + Intergenic
978963971 4:114719268-114719290 ATATTTCAACATATGAAATTTGG + Intergenic
979086766 4:116421705-116421727 AGGTTTTAACACATGAAATTTGG + Intergenic
979116966 4:116836949-116836971 AGATTTTAACATACGAATTTTGG - Intergenic
979135159 4:117102236-117102258 AGGTTTTAACATATGAATTTTGG + Intergenic
979413795 4:120411230-120411252 AGGTAGTAACATATTGAATGGGG + Intergenic
979447699 4:120834241-120834263 AGATTTCAACATATGAATTTGGG - Intronic
979524440 4:121702542-121702564 AGTTTCTAACACATGGACTTTGG + Intergenic
979531647 4:121774663-121774685 AGGATTTAACATATGAATTGGGG - Intergenic
979646052 4:123070681-123070703 AGATTTCAACATATGCATTTTGG + Intronic
979655072 4:123182805-123182827 AGCTTTTATTATATGAAATTTGG - Intronic
979719598 4:123883283-123883305 AGATTTCAACATATGAATTTTGG - Intergenic
979808151 4:125001067-125001089 AGTTGATTACATATGGAATTTGG + Intergenic
979824308 4:125214672-125214694 AGGTTTCAACACATGAATTTTGG + Intergenic
979983925 4:127292252-127292274 AGATTTTAACATATGAATTTTGG - Intergenic
980023212 4:127733638-127733660 ATGTTTTAAAATAAGGAAGTTGG - Intronic
980145618 4:128980047-128980069 AGGTTTTAAGATAAGAAATAGGG - Intronic
980169062 4:129264834-129264856 GGATTTTAACATATGAATTTTGG + Intergenic
980259100 4:130424873-130424895 AGGTTTTATCATATAAATTTCGG - Intergenic
980297305 4:130938327-130938349 ATGTTTTAACATATGCAAATTGG - Intergenic
980492461 4:133545679-133545701 AAGTTTCAACATATGAATTTTGG + Intergenic
980609176 4:135135282-135135304 GGGTTTCAACATACGGATTTGGG - Intergenic
980653548 4:135752150-135752172 AGCTTTTAACCTATAGGATTAGG + Intergenic
980830208 4:138121925-138121947 AAGTTAGAACATATGGTATTTGG - Intergenic
980851086 4:138382531-138382553 ACGTTTTGATATTTGGAATTAGG + Intergenic
980900780 4:138902935-138902957 AGGTTTCAACATATGAACATGGG + Intergenic
981016182 4:139976952-139976974 AGGTTTTAACATATGAATTTTGG - Intronic
981050736 4:140306960-140306982 AGGTTTCAACATATGTATTTGGG - Intronic
981106740 4:140890446-140890468 AGCTTTCAACATATGAATTTGGG - Intronic
981161095 4:141499676-141499698 AGATTTCAACATATGGACTTTGG + Intergenic
981301592 4:143192744-143192766 AGATTTTAACATACGAATTTTGG + Intronic
981402713 4:144332618-144332640 AGTTTTCAACATATGAATTTTGG + Intergenic
981786081 4:148481065-148481087 AAGTTTCAACATATGCATTTTGG - Intergenic
981879151 4:149588484-149588506 GGGCTTTGACATATGGATTTAGG - Intergenic
981909988 4:149967838-149967860 AGTTTTCAACATATGAACTTTGG - Intergenic
982079797 4:151778240-151778262 AGGTTTCAACACGTGGATTTGGG + Intergenic
982099582 4:151954955-151954977 AGGTTTTAACATACAAATTTTGG - Intergenic
982146971 4:152405346-152405368 AGGTATTAAGATAGGGGATTTGG + Intronic
982165184 4:152607770-152607792 AGATTTCAACATATGAATTTTGG - Intergenic
982344884 4:154346169-154346191 GGGTTTCAACATATGAATTTTGG + Intronic
982430137 4:155313532-155313554 TGGTTTCAACATATGAATTTTGG + Intergenic
982619112 4:157680607-157680629 AGATTTTGACAGATGGAAATTGG + Intergenic
983213814 4:164984135-164984157 AGGCTTAAACATATGAATTTTGG - Intergenic
983306991 4:166002329-166002351 AGGTTTCAACATGTGAATTTTGG + Intronic
983635071 4:169889634-169889656 AAGTTTCAACATATGAATTTTGG - Intergenic
983719259 4:170826618-170826640 AGGTTTCAACATACGAATTTTGG + Intergenic
984012558 4:174388207-174388229 AGGTTTCAACATTTGAATTTTGG - Intergenic
984056218 4:174932596-174932618 AAGTTTCAACATATGAATTTTGG + Intronic
984210205 4:176838255-176838277 AGGTTTTCACATAATGGATTCGG - Intergenic
984226417 4:177040719-177040741 AGGTTTTCACATATGTACATTGG - Intergenic
984331620 4:178327988-178328010 AGGTTTCAACATATCAATTTGGG - Intergenic
984337416 4:178410655-178410677 AGGTTTCAACATATACATTTGGG + Intergenic
984337443 4:178410898-178410920 AGGCTTTAACATATTAATTTGGG - Intergenic
984462209 4:180052712-180052734 AGGTTTCAACTTATGAATTTGGG - Intergenic
984600393 4:181719667-181719689 AGGTTAAAACATATGAATTTGGG + Intergenic
984709930 4:182876429-182876451 AAGTTTTGACATATGAATTTGGG - Intergenic
984982926 4:185300709-185300731 AGGTTTCAACATATGAATTTGGG - Intronic
985213535 4:187622466-187622488 AAGTTTTAACAGATGAATTTTGG - Intergenic
985528440 5:419894-419916 GGATTTTAAGATGTGGAATTGGG + Intronic
985733159 5:1562880-1562902 AGGTTCCAACACATGGATTTTGG + Intergenic
986226783 5:5823315-5823337 AGGTTTTAAAATCTGAAAATGGG + Intergenic
986694745 5:10341629-10341651 AGATTTTAACATATGAATTTTGG + Intergenic
986962617 5:13234009-13234031 AAGTTTTAAAATATGTAAATAGG - Intergenic
986998068 5:13629824-13629846 AGGTTTCAGCATTTGGATTTGGG + Intergenic
987081025 5:14425625-14425647 AGATTTCAACATACGGATTTTGG - Intronic
987237553 5:15958140-15958162 AAGTTTTAACATTTGAATTTTGG + Intergenic
987366102 5:17150622-17150644 ATGTTCTGACATCTGGAATTCGG - Intronic
987588640 5:19892984-19893006 AGGTTTTAACATATGACTTTTGG - Intronic
987660541 5:20867647-20867669 AGGATTCAACATATGAATTTTGG + Intergenic
987718202 5:21598380-21598402 AGATTTCAACATATGAATTTTGG + Intergenic
987774673 5:22348944-22348966 GGATTTTAACATATGAATTTTGG - Intronic
987831581 5:23102419-23102441 AGATTTTAAAATTTGGAATGTGG - Intergenic
987868312 5:23575098-23575120 GGATTTAAACATATGGATTTTGG + Intergenic
987905984 5:24077952-24077974 GGGCTTCAACATATGGATTTGGG - Intronic
988037691 5:25849866-25849888 GGGCTTCAACATATGAAATTGGG + Intergenic
988084753 5:26460669-26460691 AGATTTCAACATATGAATTTGGG + Intergenic
988149151 5:27353662-27353684 AGGTTGCAACATATGAATTTTGG - Intergenic
988273199 5:29044815-29044837 AGGTTTTAAAATATAAACTTTGG - Intergenic
988289385 5:29266004-29266026 AGGTTTCAACATATGAATTTGGG + Intergenic
988375675 5:30432336-30432358 TAGTTTTAACATATGAATTTTGG - Intergenic
988634688 5:32970158-32970180 AGGTTTCAACATATGAATTGGGG + Intergenic
988650277 5:33141347-33141369 AGTTTTTAACACATGAACTTTGG - Intergenic
988673168 5:33404117-33404139 AGGTTCCAACATAAGAAATTTGG - Intergenic
988695541 5:33618694-33618716 GGGTTTCAAGATATGGATTTTGG - Intronic
988763106 5:34338036-34338058 AGGATTCAACATATGAATTTTGG - Intergenic
988779634 5:34508516-34508538 AGCTTTCAACATATGAATTTGGG - Intergenic
988801421 5:34699640-34699662 GGGCTTCAACATATGGATTTTGG + Intronic
988978389 5:36538490-36538512 AGAATTTTACCTATGGAATTGGG + Intergenic
989098518 5:37803319-37803341 GGATTTTAACATATGAATTTGGG - Intergenic
989154845 5:38334560-38334582 AGAGTTTAACATATGAATTTTGG + Intronic
989182606 5:38593647-38593669 GGATTTTAACATATGAATTTGGG - Intronic
989405093 5:41051536-41051558 AGATTTCAACATATGAATTTTGG - Intronic
989646646 5:43641039-43641061 AGAGTTTAACTTATGGTATTAGG + Intronic
989691233 5:44146881-44146903 CGGTTTTAACATATGAATTTTGG - Intergenic
989753773 5:44926157-44926179 AGGTTTCAACATATGAAATTGGG + Intergenic
989777628 5:45227913-45227935 GGGTTTTAAGATATGAACTTTGG - Intergenic
989777761 5:45229970-45229992 AGGTTTCAACATATGAATTCTGG - Intergenic
990033451 5:51290093-51290115 AGGTTTCAACATATGAATTTTGG + Intergenic
990160040 5:52927834-52927856 AAGTATTAACATATGAATTTTGG - Intronic
990354477 5:54952357-54952379 AGGTTCCAACATATGAATTTCGG + Intergenic
990427994 5:55707754-55707776 AAGTTTCAACATATGAATTTTGG - Intronic
990840109 5:60069181-60069203 AAGATTCAACATATGGATTTTGG - Intronic
990867097 5:60391641-60391663 ACCTTTTAAAATATTGAATTGGG + Intronic
990910838 5:60850565-60850587 AGGTTTGAACATATGAATTTAGG + Intergenic
990911243 5:60854614-60854636 AGGTTTCAACATATGGATTTAGG + Intergenic
990949673 5:61286243-61286265 AGGTTTTAACATCTGAATTTGGG + Intergenic
990957879 5:61361967-61361989 ATGTTTTCACATATGGAAATAGG + Intronic
991039953 5:62164895-62164917 GGATTTCAACATATGAAATTTGG + Intergenic
991218826 5:64188868-64188890 AGGCTTTAACATATGAATTTTGG - Intronic
991226296 5:64277074-64277096 GGGTTTAAACATATGAATTTTGG - Intronic
991301137 5:65130271-65130293 AGGTCTCAACATATGAATTTGGG + Intergenic
991321859 5:65383121-65383143 AGGTTTTAACATACAAATTTTGG + Intronic
991335506 5:65542148-65542170 AGATTTCAACGTATGGATTTTGG + Intronic
991396000 5:66206059-66206081 AGGTTTCAATATATGAATTTTGG + Intergenic
991415945 5:66393067-66393089 AAGTTTTAACTTGTGGACTTTGG + Intergenic
991441149 5:66650825-66650847 AGGTTTTACCACATGTATTTGGG - Intronic
991653071 5:68875896-68875918 TGATTTTAACATATGAATTTTGG - Intergenic
991929073 5:71733780-71733802 AAGTTTCAACATATGAATTTTGG + Intergenic
991941376 5:71855684-71855706 TGTTTTTAACATATGTAATGAGG + Intergenic
991943274 5:71875759-71875781 AAGTTTTAACATATGAATATTGG - Intergenic
992110600 5:73488957-73488979 GGGTTTCAACATATGAATTTCGG + Intergenic
992181898 5:74205664-74205686 AGGCTTCAACATATGAATTTTGG - Intergenic
992408388 5:76481137-76481159 AAGTTTCAACATATGAATTTGGG + Intronic
992646940 5:78819929-78819951 GGGTTCCAACATATGGATTTTGG - Intronic
992807764 5:80354277-80354299 AGGTTTCAACATATGAATTGGGG + Intergenic
992818877 5:80473668-80473690 AGATTTGAACAAATGGAATGAGG - Intronic
992911552 5:81400610-81400632 AGGTTTCAACAGATGAATTTTGG - Intergenic
993172342 5:84435127-84435149 AGATTTCAACATATGAATTTGGG - Intergenic
993281692 5:85933346-85933368 AAGTTTTAACATTTGAATTTGGG - Intergenic
993300126 5:86198368-86198390 AGGCTTGATCATATGGGATTTGG + Intergenic
993325199 5:86525816-86525838 GGATTTTAACATATGAATTTGGG + Intergenic
993334087 5:86635166-86635188 ATGTTTCAACATATGAATTTGGG + Intergenic
993355058 5:86895772-86895794 AGGTTTGAACATATTTATTTGGG - Intergenic
993434899 5:87880558-87880580 AGGTTTTAACATATGAATTTGGG + Intergenic
993575398 5:89593068-89593090 AGGTTTCAACGTATGAATTTTGG + Intergenic
993587918 5:89755324-89755346 AGGTTCCAACACATGAAATTTGG - Intergenic
993664129 5:90673767-90673789 AGATTTTAACATAGGAATTTGGG + Intronic
993699117 5:91097373-91097395 AGGTTTCAACATATAAAGTTTGG + Intronic
993756028 5:91731586-91731608 GGGTTTCAACATATGAATTTTGG - Intergenic
993850949 5:93008502-93008524 AGGTTTCAAGATATGAATTTTGG - Intergenic
993923532 5:93837196-93837218 AGGTGAGAACATATGGTATTTGG + Intronic
994047687 5:95328189-95328211 AGGTTTCAACATATGAAGTCTGG - Intergenic
994076759 5:95660359-95660381 AGATTTTAACATAAGAATTTGGG + Intronic
994117571 5:96078235-96078257 GGGTTTCAACATATGAATTTTGG + Intergenic
994256517 5:97602852-97602874 AGATTTTAACATATTAATTTAGG - Intergenic
994285758 5:97964087-97964109 AGGTTTCAACATATGAATTTTGG - Intergenic
994465132 5:100117579-100117601 AGGCTTTCACATATGAATTTTGG - Intergenic
994564032 5:101417283-101417305 AGGTTTCAACATATACATTTTGG + Intergenic
994569968 5:101503610-101503632 GGTTTTCAACATATGGAACTTGG + Intergenic
994630059 5:102274403-102274425 ATGTTTTGACATATGGTATGTGG - Intronic
994729944 5:103480338-103480360 AGGTTTCAACAAATGAAATTGGG - Intergenic
994733427 5:103522299-103522321 AGGTTCCAACATATGAATTTTGG - Intergenic
994856655 5:105130307-105130329 GGGTTTTAAGATATGGATTTTGG + Intergenic
995368365 5:111389320-111389342 AGGTTTCAACATATGAATTTGGG + Intronic
995568079 5:113452333-113452355 AAGTTTTAACATATGAATTTGGG - Intronic
995683788 5:114748906-114748928 GGGTTTCAACATATGAATTTTGG - Intergenic
996058643 5:119008342-119008364 AGTTTTCAACATATGAATTTTGG + Intergenic
996116088 5:119620633-119620655 TCTTTTTAACATATCGAATTTGG + Intronic
996182255 5:120433124-120433146 AGGTTTTAAGATATGGCATTTGG + Intergenic
996235293 5:121121519-121121541 TGTTTTTTACATATGCAATTAGG + Intergenic
996258382 5:121434840-121434862 AGGGTTTAATATATGAATTTGGG - Intergenic
996439834 5:123477740-123477762 AGGTTTCAACATATGAATTTTGG - Intergenic
996467457 5:123820338-123820360 AAGTTTCAACATATGAATTTTGG - Intergenic
996472303 5:123875117-123875139 TGGTTTTAGCATAATGAATTAGG + Intergenic
996643674 5:125790080-125790102 AGGTTTCAACATATAAATTTTGG - Intergenic
996728894 5:126698045-126698067 AGGTTCTAACATATGAATTTTGG + Intergenic
996804720 5:127441640-127441662 AGGTTTTATCATAAGAAAGTGGG - Intronic
997559936 5:134837515-134837537 AGGTTTCAACATCATGAATTTGG - Intronic
997849960 5:137323111-137323133 AGTTTTTAACATGTGCATTTTGG + Intronic
997909373 5:137854825-137854847 AGGTTTCAACATGTGAATTTTGG - Intergenic
998351914 5:141507660-141507682 TGTTTTTAACATCTGGATTTAGG - Intronic
999136611 5:149324449-149324471 AGGTTTCAACATATGAATTTTGG + Intronic
999461780 5:151763057-151763079 AGGTTTCAACATACGAATTTTGG - Intronic
999552415 5:152703877-152703899 AGGTTTAAACTAATGGGATTTGG + Intergenic
999671536 5:153962899-153962921 AAGTTTTAATATGTGGATTTTGG + Intergenic
999886704 5:155932098-155932120 AGATTTCAACATATGAATTTTGG + Intronic
999899881 5:156075470-156075492 AGATTTCAACATTTGGGATTTGG + Intronic
1000221676 5:159220390-159220412 AGATTTTAACATATGAATTTTGG - Intergenic
1000642669 5:163721142-163721164 AGGATTTAGCTTATGGACTTCGG - Intergenic
1000669198 5:164039602-164039624 AGATTTTCACATATGAAATTTGG + Intergenic
1000684886 5:164236192-164236214 TGGTTTAAACATATGGATTTGGG - Intergenic
1000756946 5:165173221-165173243 AGTTTCTAACACATGGATTTTGG - Intergenic
1000855615 5:166394511-166394533 AGGTTTCAACATATGAACTTTGG + Intergenic
1000929411 5:167232903-167232925 AGGTTTTAACATATGTTTTTGGG - Intergenic
1000962100 5:167611895-167611917 AGGTTTTAACATATGAATTTTGG + Intronic
1001235665 5:170027281-170027303 AGGTTTCCACATCTGGAACTAGG + Intronic
1001886781 5:175299432-175299454 AGGTTTAAACATATAAATTTTGG - Intergenic
1001965049 5:175904132-175904154 AGGTTTCAACGTATGAATTTTGG + Intergenic
1002251906 5:177935056-177935078 AGGTTTCAACGTATGAATTTTGG - Intergenic
1002436855 5:179236844-179236866 AGGTTTCAACATATGAATTTTGG - Intronic
1002788479 6:421616-421638 AGTTTTCAACACATGAAATTTGG + Intergenic
1002812101 6:640495-640517 TGGGTTTAACATATGAAATTTGG - Intronic
1003058644 6:2844572-2844594 AAGTTTCAACATATGAATTTTGG + Intergenic
1003153620 6:3572940-3572962 TGGTTTTAACAAATTGAAGTTGG + Intergenic
1003243187 6:4362009-4362031 GGGTTTCAACATATGCATTTCGG + Intergenic
1003280617 6:4688066-4688088 AGGTTTTAAAATTTGGAATTTGG - Intergenic
1003400830 6:5789394-5789416 AGGTTTAACCATATGGCATCTGG - Intergenic
1003488864 6:6603229-6603251 AGGTTTTAACATATAAATCTGGG + Intronic
1003561213 6:7182148-7182170 AGGTTTTATCATAGGAAACTCGG - Intronic
1003744183 6:8981069-8981091 AGGTTTCAACATATGAATTTTGG - Intergenic
1003759728 6:9163546-9163568 AGCTTTTTGGATATGGAATTCGG - Intergenic
1003946190 6:11078139-11078161 AAGTTTCAACATATGAATTTTGG - Intergenic
1003980892 6:11388792-11388814 AGGTTCCAACATATGAATTTTGG - Intergenic
1004387733 6:15187097-15187119 AGGTTTCAACGTATGAATTTTGG - Intergenic
1004416088 6:15425451-15425473 AGTTTCTAACACATGAAATTTGG - Intronic
1004604260 6:17179077-17179099 GGGCTTCAACATATGGATTTTGG - Intergenic
1004759797 6:18654197-18654219 AGGTTTCAACATAGGAATTTTGG - Intergenic
1004899637 6:20182393-20182415 AGGTTTCAACATATGAATTTTGG + Intronic
1005023549 6:21440987-21441009 GGGTTTCAACATATGGATTCTGG - Intergenic
1005052541 6:21698160-21698182 AGACTTCAACATATGGACTTGGG + Intergenic
1005190522 6:23216567-23216589 GGGCTTCAACATATGGATTTGGG + Intergenic
1005317780 6:24620859-24620881 AGCTTTTAACATATGAATTTTGG + Intronic
1005694752 6:28341542-28341564 AGGTTTAAACATAAGAATTTTGG + Intronic
1006241491 6:32683772-32683794 AGGTTTTAATATACGAATTTTGG - Intergenic
1006966342 6:37989576-37989598 AGGCTTTAACATACGAATTTTGG + Intronic
1007165913 6:39828920-39828942 AAGTTTCAACATATGCATTTTGG + Intronic
1007192847 6:40034499-40034521 AGGTTTTAACAGAAGAGATTTGG + Intergenic
1007309148 6:40931621-40931643 GGATTTTAACATATGAATTTTGG - Intergenic
1007318511 6:41009353-41009375 GGGTTTCAACATTTGGATTTTGG + Intergenic
1007799229 6:44377900-44377922 AGGTTTCGACATATGCATTTTGG + Exonic
1007920754 6:45607429-45607451 AGGTTTTCCCTTGTGGAATTAGG + Intronic
1007928377 6:45668450-45668472 AGGTTCCAATATATGGATTTTGG + Intergenic
1008142074 6:47843538-47843560 AGGTTTCAACATATGCATTTTGG + Intergenic
1008858777 6:56123954-56123976 ATTTTTTAACATGTGGCATTGGG - Intronic
1008881345 6:56383367-56383389 AGGTTTCAACATATGAATTTGGG + Intronic
1008944812 6:57086271-57086293 TGGTTTTAAGATGTGGAACTGGG - Intergenic
1009294565 6:61929948-61929970 GAGTTTTAACATATGAATTTTGG - Intronic
1009304780 6:62075143-62075165 AGGTTTCAACATATGAATTTTGG - Intronic
1009399552 6:63238010-63238032 AGTTTCTAACATATGAACTTTGG + Intergenic
1009519623 6:64664573-64664595 AGATTTCAACATATGAATTTGGG - Intronic
1009532613 6:64839940-64839962 AAGTTTTAACACATGAATTTTGG + Intronic
1009603356 6:65833258-65833280 AGGTTTCAACATATGCATTTGGG + Intergenic
1009623168 6:66101488-66101510 AGGTTTCAACATATGAATTTTGG + Intergenic
1009841838 6:69087389-69087411 AAGTTTCAACATATGAATTTTGG - Intronic
1009845565 6:69130301-69130323 GGATTTTAACATATGAATTTTGG + Intronic
1009872023 6:69465379-69465401 AGATTTCAACATATGCATTTTGG - Intergenic
1009878729 6:69538730-69538752 AGGTTGCAAGGTATGGAATTTGG + Intergenic
1009987257 6:70795632-70795654 AGGTTTTAACATGTGAATTTTGG + Intronic
1010247428 6:73674639-73674661 AGGTTTCAACATACGAATTTGGG - Intergenic
1010303000 6:74283218-74283240 TGATTTTAAGATGTGGAATTGGG + Intergenic
1010433849 6:75808504-75808526 AGGCTTAAACATATGAATTTGGG + Intronic
1010634292 6:78238664-78238686 ATGTTTTAACATCCTGAATTAGG - Intergenic
1010719976 6:79272081-79272103 GGGTGTTAACATATGAATTTTGG - Intergenic
1010943721 6:81950387-81950409 AGGTTTCAACATGTGAATTTGGG + Intergenic
1011081235 6:83491954-83491976 AGGTTTCAACATATAAATTTGGG + Intergenic
1011183987 6:84653774-84653796 AGGTTTTAACACATGGATTTTGG + Intergenic
1011264291 6:85498873-85498895 AGGTTTCAACATACAGAGTTTGG + Intergenic
1011292438 6:85790743-85790765 AGGTTTTAACATATGAATTTTGG + Intergenic
1011441397 6:87391060-87391082 AGGTTTCAACATGTGCATTTTGG + Intronic
1011517892 6:88172309-88172331 AAGTTTCAACATATGAACTTTGG - Intergenic
1011648850 6:89486952-89486974 GGGTTTAAACATATGAATTTGGG + Intronic
1011968109 6:93185984-93186006 AGGTTTCAACATATAAATTTTGG - Intergenic
1012042542 6:94227285-94227307 AGATTTGAACCTAAGGAATTTGG + Intergenic
1012054551 6:94389092-94389114 AGGTTTCAACATATGAATTTTGG + Intergenic
1012272755 6:97235250-97235272 AGGTTTTTGCATAAGGAAATAGG + Intronic
1012440608 6:99258950-99258972 AGTTTTCAACATATGAATTTTGG + Intergenic
1012810038 6:103945199-103945221 AGGCTTCAACATATGAATTTTGG + Intergenic
1013260553 6:108437164-108437186 AGGTTTCAACATATGAATTCTGG + Intronic
1013286342 6:108685458-108685480 AGGTTTTAAAGTTGGGAATTTGG + Intergenic
1013632076 6:111995656-111995678 AGGTTTCAACATATGAATCTGGG + Intergenic
1013692015 6:112657063-112657085 GGGTTTCAACATATGAATTTGGG - Intergenic
1013693314 6:112670459-112670481 AGGTTGCAACATATGTATTTTGG + Intergenic
1013747184 6:113359425-113359447 AGGTTTCAACATATGAATTTTGG + Intergenic
1013754286 6:113442916-113442938 AGGGTTCAATATATGAAATTTGG - Intergenic
1013823285 6:114180820-114180842 TGGTTTTAACATATGAATTTTGG + Intronic
1013840493 6:114386733-114386755 AGGTTTCAGCATATGAATTTTGG - Intergenic
1013919074 6:115378961-115378983 AGATTTCAACATGTGGATTTGGG - Intergenic
1014014724 6:116517200-116517222 AGATTTCAACATATGAAATTGGG + Exonic
1014114228 6:117654361-117654383 GGGCTTCAACATATGGATTTTGG + Intergenic
1014173345 6:118303893-118303915 AGGCTTCAACATATGAATTTTGG + Intronic
1014244633 6:119054577-119054599 AGATTTCAACATATGAAGTTTGG + Intronic
1014259549 6:119200388-119200410 ATATTTTAGCATATGGATTTTGG + Intronic
1014259706 6:119202855-119202877 GGGTTTCAGCATATGAAATTAGG - Intronic
1014294874 6:119605827-119605849 AGGTTTCAATATATGAATTTTGG + Intergenic
1014394016 6:120901831-120901853 GGGTTTTAATATATGAAATTGGG - Intergenic
1014493122 6:122087400-122087422 AGGGTTCAACATATGAATTTTGG - Intergenic
1014642175 6:123926153-123926175 AGATTTCAACATATGAATTTGGG + Intronic
1014653076 6:124065396-124065418 AAGTTTCAACATATGAATTTTGG - Intronic
1014665105 6:124228160-124228182 AGGTTTCAACTTATGAATTTGGG - Intronic
1014680465 6:124423562-124423584 AAGTTTCAACATATGCATTTGGG - Intronic
1014775886 6:125509487-125509509 GGATTTTAACATATGAATTTTGG - Intergenic
1014828386 6:126072909-126072931 AGACTTCAACATATGGATTTTGG + Intergenic
1014850767 6:126337223-126337245 AGATTTCAACATATGAATTTTGG + Intergenic
1014879169 6:126701069-126701091 AGGTTTTAGCAAATGAATTTTGG + Intergenic
1014993297 6:128109000-128109022 GGGCTTCAACATATGGATTTTGG + Intronic
1015182828 6:130379144-130379166 AGTTTTTAACACATGAAGTTTGG + Intronic
1015340137 6:132089777-132089799 GGGCTTCAACATATGGATTTGGG - Intergenic
1015344347 6:132138341-132138363 AGACTTAAACATAGGGAATTAGG + Intergenic
1015344982 6:132145854-132145876 AGATTTTAGCATATGAATTTTGG - Intergenic
1015477574 6:133670729-133670751 GGGGTTTAACATAGGGAATCTGG - Intergenic
1015542278 6:134326965-134326987 GGGCTTTAACATATGAATTTTGG + Intergenic
1015570309 6:134614289-134614311 GGGTTTTAACATATGACTTTGGG + Intergenic
1015656528 6:135525009-135525031 AGGTTTCAACATATGAATTTTGG - Intergenic
1015948748 6:138530077-138530099 AGATTTTAACATAAGAATTTTGG - Intronic
1016180742 6:141145144-141145166 GGGTTTTAAGATATGGATCTTGG + Intergenic
1016198260 6:141374050-141374072 AGGTTTCAACATTTAAAATTTGG - Intergenic
1016294752 6:142562777-142562799 AGATTTTACCATATGAATTTGGG + Intergenic
1016299229 6:142611396-142611418 AGGCTTTAACATGTGAATTTTGG + Intergenic
1016456232 6:144233980-144234002 AGGATTTAACATATGAATTAGGG - Intergenic
1016546534 6:145230360-145230382 AAGTCTTAGCATATGGATTTTGG + Intergenic
1016634049 6:146267121-146267143 AAGTGAGAACATATGGAATTTGG + Intronic
1016645944 6:146408276-146408298 AGATTTTAACATATGAGTTTTGG + Intronic
1016683804 6:146859382-146859404 AGATTTCAACGTATGGATTTTGG - Intergenic
1016860239 6:148710546-148710568 GGGATTCAACATATGGATTTTGG + Intergenic
1016907619 6:149167225-149167247 AGTTGTTAAAATATGGAAATAGG - Intergenic
1016956232 6:149629253-149629275 GGGCTTTAACATATGAACTTTGG - Intronic
1016982749 6:149867948-149867970 AGGTTTCAACATAGGAATTTTGG + Intergenic
1017282684 6:152640596-152640618 AGGTTTCAACATATGAGTTTGGG - Intergenic
1017681510 6:156868705-156868727 AGATTTCAACATATGAATTTTGG + Intronic
1018072701 6:160179510-160179532 AGGTTTTAACCCATGAATTTTGG + Intronic
1018154010 6:160968831-160968853 AGGTTTTAACATATGAATTTGGG - Intergenic
1018255440 6:161913744-161913766 TGGTTTCAACATATGAATTTGGG - Intronic
1018382995 6:163276600-163276622 AGATTTCAACATATGCATTTTGG - Intronic
1018490980 6:164293188-164293210 GGGTTTCAACATATGAACTTAGG - Intergenic
1018564129 6:165133685-165133707 AGATTTCAACATATGAATTTTGG - Intergenic
1018604345 6:165581272-165581294 AGGCTTCAACATATGAATTTTGG - Intronic
1018797088 6:167194479-167194501 AGGTTTCAACATACGAATTTGGG + Intronic
1018819251 6:167360609-167360631 AGGTTTCAACATACGAATTTGGG - Intronic
1018832220 6:167451901-167451923 GGGCTTCAACATATGGATTTGGG + Intergenic
1019886672 7:3911608-3911630 AGGTTTCAACATATGAATTTTGG + Intronic
1020403444 7:7803842-7803864 AGGTTTCAACATACGAATTTTGG + Intronic
1020474590 7:8580856-8580878 ATATTTTAACATCTGGAACTTGG + Intronic
1020514782 7:9104666-9104688 AGGTTTCAACATATGAATTTTGG + Intergenic
1020835273 7:13141947-13141969 AGGTTTCAGCATATGAATTTTGG - Intergenic
1021052374 7:16004088-16004110 AGATTTTAACACATAAAATTGGG + Intergenic
1021605370 7:22404317-22404339 AGGTTTCAACATATAAATTTGGG + Intergenic
1021694994 7:23267765-23267787 GGGTTTCAACATATGAATTTCGG + Intronic
1021734452 7:23629163-23629185 AGGTTTCAACATATGAATTTTGG - Intronic
1021845817 7:24761576-24761598 AAGTTTCAACATATGGCTTTGGG + Intergenic
1022022247 7:26412053-26412075 GGGCTTCAACATATGGATTTTGG - Intergenic
1022059818 7:26782480-26782502 AGGTTTTAATATATGAATTTGGG - Intronic
1022074341 7:26952843-26952865 GGGTTTTAAAATATGAATTTTGG - Intronic
1022086000 7:27068105-27068127 AGATTTAAATATAGGGAATTAGG - Intergenic
1022198850 7:28096047-28096069 GGGCTTCAACATATGAAATTTGG + Intronic
1022283715 7:28935304-28935326 AAGTTTCAACATATGAATTTGGG + Intergenic
1022371261 7:29773747-29773769 AGGTTTCAACATATAAATTTGGG - Intergenic
1022434295 7:30365089-30365111 AGGTTTTAACATAGCAATTTTGG + Intronic
1022795716 7:33730035-33730057 AGGATTTCACTTATGGATTTGGG - Intergenic
1023215186 7:37854778-37854800 AGGTTTCAAGATATGGATGTTGG - Intronic
1023280641 7:38565660-38565682 GGGTTTCAACATATGAATTTGGG + Intronic
1023305572 7:38822815-38822837 AGGTTTCAACGTAATGAATTTGG - Intronic
1023305592 7:38823077-38823099 AGGTTTCAACACAGTGAATTTGG - Intronic
1023361766 7:39424216-39424238 AGGTTTCAACATGTGAAGTTTGG + Intronic
1023707657 7:42958805-42958827 ACATTATAACATATGTAATTGGG - Intergenic
1023770444 7:43552017-43552039 AGATTTCAACATATGAATTTGGG + Intronic
1023900753 7:44476684-44476706 AGGTACTAAGAAATGGAATTCGG + Intronic
1023989574 7:45120270-45120292 AGATTTCAACATATGAATTTTGG + Intergenic
1024256609 7:47544378-47544400 GGATTTCAACATATGGATTTTGG - Intronic
1024577612 7:50777377-50777399 AGGTTTCAACACATGAATTTTGG + Intronic
1024716354 7:52083585-52083607 AGGTCTCAACATATGAATTTTGG + Intergenic
1024760832 7:52594566-52594588 GGTTTTTAACATATGAATTTGGG - Intergenic
1024804289 7:53118755-53118777 AAGTTTCAACACATGCAATTTGG - Intergenic
1026104564 7:67410636-67410658 AGGTTTCAACATATACAATTTGG - Intergenic
1026276707 7:68885150-68885172 GGGATTCAACATATGGATTTTGG + Intergenic
1026308188 7:69160725-69160747 GGATTTCAACATATGGATTTGGG - Intergenic
1026859394 7:73775768-73775790 ATGTTTTAATAAATGGAATCAGG - Intergenic
1027377996 7:77573533-77573555 ATGTTTTAACTTATGAATTTGGG + Intronic
1027390949 7:77702978-77703000 AGGCTTCAACATATGGATTTTGG + Intronic
1027625447 7:80539248-80539270 AAGTTTCAACATATACAATTTGG - Intronic
1027735671 7:81930322-81930344 GGGTTTTAACATATGAATTTTGG - Intergenic
1027834798 7:83227263-83227285 AGGTTTCAACATATGAATTTGGG - Intergenic
1027898530 7:84078081-84078103 GGTCTTTAACATATGGAATTTGG + Intronic
1027950515 7:84809091-84809113 AGGTTCCAACATATGAATTTGGG + Intergenic
1027992550 7:85380938-85380960 AAGTTTCAACATATGAATTTTGG + Intergenic
1028104242 7:86858340-86858362 AGTTTTCAACACATGAAATTTGG - Intronic
1028175362 7:87650569-87650591 AGGTATCAACATATGAATTTTGG + Intronic
1028291328 7:89068676-89068698 ATGTTTTAACATTTTTAATTTGG + Intronic
1028331460 7:89599940-89599962 AAGTTTTAACATATGAATTTTGG - Intergenic
1028587025 7:92462630-92462652 GGGCTTTAACATATGAACTTGGG - Intergenic
1028776859 7:94687430-94687452 AGATTTCAACATATGAATTTTGG + Intergenic
1028896470 7:96047251-96047273 AAGTTTCAACATATGAATTTTGG + Intronic
1028900910 7:96099765-96099787 AGGCTTCAACATATGAATTTGGG + Intronic
1029054026 7:97721235-97721257 GGGTTTCAACATATGAATTTTGG + Intergenic
1029628928 7:101738262-101738284 AGGCTGTGATATATGGAATTTGG + Intergenic
1030175290 7:106646916-106646938 AGGTTTCAACATATGCATTTGGG - Intergenic
1030240816 7:107322147-107322169 AGGTTTCAACATATGAATTTGGG - Intronic
1030333243 7:108295628-108295650 AGGCTTCAACATATGAATTTTGG + Intronic
1030541706 7:110838416-110838438 AGTTTCTAACACATGAAATTCGG - Intronic
1030568320 7:111188553-111188575 AGATTTCAACATATGAATTTGGG + Intronic
1030569209 7:111201378-111201400 AGGTTTCAACATAGGAATTTTGG - Intronic
1030674230 7:112367820-112367842 AGTTTCCAACATATGAAATTTGG + Intergenic
1030786951 7:113674240-113674262 AAATTTTAACATATGAATTTTGG - Intergenic
1030866224 7:114704551-114704573 GGATTTCAACATATGGATTTAGG + Intergenic
1030874818 7:114800689-114800711 AGGTTCCAACATATGCATTTTGG + Intergenic
1030884277 7:114919670-114919692 AGATTTTAGCATATGAATTTTGG + Intergenic
1030895636 7:115056385-115056407 ATATTTTAGCATATGGATTTTGG + Intergenic
1031006797 7:116482610-116482632 AGGCTTCAACATATGAAATTGGG + Intronic
1031041172 7:116839871-116839893 GGATTTTAACATATGAATTTTGG - Intronic
1031161898 7:118178915-118178937 AGGTTCCAACATATGAATTTTGG - Intergenic
1031313109 7:120224283-120224305 CTGTTTTAATATATGGACTTAGG - Intergenic
1031447097 7:121868283-121868305 AGGTTTCAACATATGAATTTTGG - Intergenic
1031548204 7:123076604-123076626 AAGTTTCAACATATGAATTTGGG - Intergenic
1031581823 7:123485435-123485457 GGATTTCAACATATGGATTTGGG + Intronic
1031637889 7:124123382-124123404 AGGTTTTAACATCTGAATTTGGG + Intergenic
1031642152 7:124178477-124178499 AGGTTTCAACATGTGAATTTTGG + Intergenic
1031650374 7:124281957-124281979 AGGGTTTAACATATAAACTTTGG - Intergenic
1031656234 7:124359726-124359748 GGGTTTCAACATATGAATTTGGG + Intergenic
1031808731 7:126339586-126339608 AGGTTTTGATATTTAGAATTGGG - Intergenic
1032139521 7:129314700-129314722 AGGTTTCAACATATGAATTTGGG + Intronic
1032711161 7:134461648-134461670 AGGTTTTATCCTATGGGAATTGG - Intergenic
1033092761 7:138402361-138402383 AGGTTTCAACACATGAATTTTGG - Intergenic
1033117752 7:138640671-138640693 AGGTGAGAACATATGGTATTTGG - Intronic
1033310915 7:140261152-140261174 AGGCTTCAACATATGAATTTTGG - Intergenic
1033490167 7:141835516-141835538 AGGTTTCAACTTATGAATTTTGG + Intergenic
1033780361 7:144662204-144662226 AGGTTTCAACATACGAATTTTGG - Intronic
1033975511 7:147095443-147095465 AGGTTTTAACATAGGAATTTTGG + Intronic
1034052345 7:147996877-147996899 AGGTTTCAACATATAAATTTTGG - Intronic
1034108640 7:148514640-148514662 AGGTTTGAACATATGAATTTGGG - Intergenic
1034341111 7:150356108-150356130 GGGTTTGAACATATGAATTTGGG - Intergenic
1034481865 7:151327947-151327969 AGGCTTCAACATATGAATTTTGG - Intergenic
1034862674 7:154613172-154613194 AGGTTTCAACATATGAATTCTGG + Intronic
1034937069 7:155207071-155207093 AGACTTCAACATATGGATTTGGG + Intergenic
1034985177 7:155508488-155508510 AGGTTTCCACATAAGGAATCAGG - Intronic
1034986229 7:155517094-155517116 GGGCTTCAACATATGGATTTTGG - Intronic
1035003726 7:155639058-155639080 AGGTTTCAACATATGAATTTGGG + Intronic
1035835037 8:2740961-2740983 AGATATTAACATATGACATTTGG + Intergenic
1036049487 8:5179974-5179996 AGTTTTCAACACATGAAATTTGG - Intergenic
1036138877 8:6188031-6188053 AGATTTTCACATATGGAGTCAGG - Intergenic
1036503494 8:9334800-9334822 GGGTTTCAACATATGAATTTTGG - Intergenic
1036608660 8:10330873-10330895 AGGCTTCAACATATGAATTTGGG - Intronic
1037130624 8:15404259-15404281 AAGTTTCAACATATGAATTTGGG + Intergenic
1037478480 8:19280552-19280574 ATGTGGTAACATATGGTATTTGG + Intergenic
1037761085 8:21742173-21742195 GGGGTTTAACATATGAATTTTGG - Intronic
1037846649 8:22288850-22288872 AGATTTGAATATATGAAATTAGG + Intronic
1038026719 8:23597336-23597358 GGATTTTAACATAGGCAATTTGG + Intergenic
1038161749 8:25046300-25046322 AGGTTTCAACATACGAATTTTGG - Intergenic
1038282485 8:26178559-26178581 AGGTTTCAACATATGAATTTGGG - Intergenic
1038315195 8:26478517-26478539 AGTTTCTAACATATGAACTTTGG - Intronic
1038340480 8:26681412-26681434 TGGTCTTAGCATCTGGAATTAGG - Intergenic
1038348111 8:26750607-26750629 ATGTTTTAACATATGGATTTTGG + Intronic
1038358016 8:26848296-26848318 GGGTTTCAACATGTGGATTTGGG - Intronic
1038381293 8:27096755-27096777 AGGTTTTTACATAGGAATTTGGG + Intergenic
1038393561 8:27229354-27229376 AGGCTTAAACATATGCATTTTGG + Intergenic
1038483331 8:27916850-27916872 AGGTTGCAACATATGAAATCGGG - Intronic
1038684754 8:29706237-29706259 AGGTTTCAACATATGAATGTTGG + Intergenic
1038882052 8:31625753-31625775 ATGTCTTAACATATGAATTTGGG - Intergenic
1039022905 8:33227173-33227195 AACTTCTCACATATGGAATTGGG - Intergenic
1039075595 8:33688192-33688214 AGGTTTCAACATATGAATTTTGG + Intergenic
1039292805 8:36114987-36115009 TGGTTTTTACATATGTTATTGGG - Intergenic
1039594119 8:38775678-38775700 AGGTTTTAACCTATGAATTTTGG + Intronic
1039655355 8:39399172-39399194 AGGCTTAAACATATGTATTTAGG + Intergenic
1039705753 8:40005816-40005838 AGGTTTTAACATATGAATTTTGG - Intronic
1040348508 8:46536831-46536853 AGGTTTTATCATAGGATATTTGG - Intergenic
1040366658 8:46724281-46724303 AGATTTCAACATATGAATTTGGG + Intergenic
1040462545 8:47662751-47662773 AGATTTCAACATATGAATTTTGG - Intronic
1040971913 8:53144420-53144442 AGATTTCAACATATGAATTTTGG + Intergenic
1041026341 8:53690621-53690643 AGGTTCTAACACATGCATTTTGG - Intergenic
1041114206 8:54518726-54518748 AGGTTTCAACATACGGATTTTGG - Intergenic
1041350497 8:56943430-56943452 AAGTTTCAACATATGAATTTGGG - Intergenic
1041516148 8:58700760-58700782 GGGTTTGAACATATGAATTTTGG - Intergenic
1041567074 8:59290708-59290730 AGGTGTCAACATATGAATTTTGG + Intergenic
1041599004 8:59693586-59693608 GGGTTTCAACATATGAATTTGGG - Intergenic
1041685071 8:60636523-60636545 GGGTTTCAACATATGAATTTGGG + Intergenic
1041742791 8:61175170-61175192 AGGTTTTAACATATGAATTTTGG - Intronic
1041749263 8:61241144-61241166 AGGATTTACCATATGCATTTTGG + Intronic
1041777971 8:61545127-61545149 AGATTTCAACATATGAATTTGGG - Intronic
1041837541 8:62233290-62233312 AGGTTTTAACATATGAATTTTGG + Intergenic
1041857805 8:62478110-62478132 GGGTTTCAACATATGCATTTTGG + Intronic
1041931397 8:63291405-63291427 AGGTTTCAACATATGAACTTTGG + Intergenic
1041940599 8:63382887-63382909 AGGTTTCAACATATGAATTTTGG - Intergenic
1042057574 8:64782246-64782268 AGGTTTCAACATATGAATCTTGG - Intronic
1042131159 8:65587864-65587886 AGTTTTCAACACATGAAATTTGG + Intergenic
1042191148 8:66188669-66188691 AGGCTTCAACATATGAATTTTGG - Intergenic
1042201222 8:66280918-66280940 AGGCTTCAACATATGAATTTGGG + Intergenic
1042202973 8:66299696-66299718 AGGTTTCAACTTATGAATTTGGG - Intergenic
1042275752 8:67003704-67003726 AAGTTTCAACATATGAACTTTGG - Intronic
1042329414 8:67562551-67562573 AGGATTCAACATATGAAGTTGGG - Intronic
1042365987 8:67936775-67936797 AGGTTTCAACATGTGAATTTGGG + Intergenic
1042406507 8:68411873-68411895 AGCTTTCAACATATGAATTTTGG - Intronic
1042425552 8:68643749-68643771 ATGTTTCAACATATGAATTTGGG + Intronic
1042639062 8:70912575-70912597 AGTTTTTGACATATTGAATCTGG + Intergenic
1042850472 8:73211441-73211463 AGGCTTCAACATATGAATTTTGG - Intergenic
1043057190 8:75453868-75453890 GGATTTTAACATATGAATTTGGG - Intronic
1043208324 8:77476144-77476166 AGGCTTCAACATATGAATTTTGG - Intergenic
1043350776 8:79358910-79358932 GGATTTTAACATATGAATTTTGG - Intergenic
1044059303 8:87614920-87614942 GGGTTTCAACATATGAATTTTGG - Intronic
1044116219 8:88337426-88337448 AGGCTTCAACATATGAATTTTGG + Intergenic
1044454278 8:92374719-92374741 ATGTTTTTACCTATGTAATTTGG + Intergenic
1044542742 8:93425983-93426005 AAGTTTCAACATATGAATTTAGG + Intergenic
1044646810 8:94452235-94452257 AGGTTTCTACATATGAATTTTGG + Intronic
1044662430 8:94604666-94604688 AAGTTTCAACATATGAATTTTGG + Intergenic
1044699497 8:94953035-94953057 AAGTTTTAACATAAATAATTGGG - Intronic
1044699799 8:94955502-94955524 AGTTTTTAACACATGAACTTTGG + Intronic
1044713015 8:95074904-95074926 AGGTTGTAAAAGAAGGAATTTGG - Intronic
1044804047 8:95986807-95986829 AGGTTTCAACATATGAATTTTGG + Intergenic
1044811067 8:96062717-96062739 AGATTTCAACATATGAATTTGGG + Intergenic
1044856113 8:96477621-96477643 AGACTTTAACATACGGATTTTGG + Intergenic
1044868785 8:96598261-96598283 AGGTTTTAACACATGGATTTTGG + Intronic
1044921043 8:97169795-97169817 AAGTTTCAACATATGAATTTTGG + Intergenic
1045399273 8:101795637-101795659 GGGTTTCAACATATGAATTTGGG + Intronic
1045495669 8:102706320-102706342 GGATTTTAACATATGAATTTGGG - Intergenic
1045543586 8:103108688-103108710 AGGTTTCAACATACGAATTTTGG + Intergenic
1046040528 8:108897850-108897872 AGGTTTTAACACATAAATTTTGG + Intergenic
1046176339 8:110580045-110580067 AGGTTTTAACATATGAATGCTGG + Intergenic
1046227018 8:111295613-111295635 AGGTTTCAAGATATGGATCTTGG - Intergenic
1046238851 8:111464083-111464105 AGATTTCAACATATGAATTTTGG + Intergenic
1046250620 8:111625235-111625257 AGTTTTCAACACATGAAATTTGG + Intergenic
1046773349 8:118138327-118138349 AGATTTAAACATATGAATTTGGG - Intergenic
1046867821 8:119170630-119170652 AGTTTTCAACATATGAACTTTGG + Intronic
1047012151 8:120684261-120684283 AGTTTTCAACATATGAATTTTGG + Intronic
1047170952 8:122491808-122491830 AGATTTTAACACATGAATTTTGG - Intergenic
1047401086 8:124548022-124548044 AAGCTTTAACATCTGGAGTTTGG + Intronic
1047551900 8:125883184-125883206 AAATTTCAACATATGGATTTTGG - Intergenic
1047855963 8:128913730-128913752 AGTTTTCAACATATGAATTTGGG + Intergenic
1048049959 8:130807392-130807414 AAGTTTCAACATATGAATTTGGG - Intronic
1048140955 8:131793752-131793774 AGACTTTAACATATGAATTTGGG + Intergenic
1048148108 8:131865304-131865326 AGGTTTCAACATACGTATTTTGG - Intergenic
1048322418 8:133410485-133410507 AGGTTTCAACACATGGGTTTTGG + Intergenic
1048492739 8:134909631-134909653 AAGTTTTAACACATGAAATTTGG + Intergenic
1048571485 8:135660619-135660641 AGGTTTCATCATATGAATTTAGG + Intergenic
1048601274 8:135921181-135921203 AGACTTTAACATATGAATTTTGG - Intergenic
1048619165 8:136112983-136113005 AGATTTTAACATATTAATTTAGG - Intergenic
1048661710 8:136611094-136611116 AGGTTTCAACATATGAACTTTGG + Intergenic
1048781888 8:138010863-138010885 GGGCTTCAGCATATGGAATTTGG + Intergenic
1048835036 8:138510782-138510804 AGGTTTCAACATATGAATTTAGG + Intergenic
1048874610 8:138827236-138827258 AGATTTCAACATATGGATTTAGG - Intronic
1048946026 8:139448127-139448149 AGGATTCAACATATGAATTTTGG + Intergenic
1049317397 8:141976628-141976650 GGGTTTTTACATATGTAATTAGG + Intergenic
1049728974 8:144166265-144166287 AAGTTCCAACATATGGATTTTGG + Intronic
1049979282 9:889256-889278 GAATTTTAACATATAGAATTCGG + Intronic
1050077994 9:1884586-1884608 AGGTTTTAACACATGAATCTGGG - Intergenic
1050445266 9:5715400-5715422 AGGTTTTAATCTATGAATTTAGG + Intronic
1050665186 9:7927798-7927820 GGGCTTCAACATATGGACTTTGG - Intergenic
1050687089 9:8183939-8183961 AGGTTTCAACATACGAATTTAGG + Intergenic
1050696382 9:8283772-8283794 GGGTTTCAACATATGAATTTGGG + Intergenic
1050916782 9:11145893-11145915 GGGTTTCAACATATGCATTTTGG - Intergenic
1050974684 9:11922669-11922691 AGATTTTAACATGTGAATTTGGG - Intergenic
1051036916 9:12758462-12758484 AGGTTTTAACCAATGAAGTTTGG - Intergenic
1051114944 9:13683855-13683877 AGGTTTCAACATATGAATTTGGG + Intergenic
1051178951 9:14390580-14390602 AGGTTTCAACATATGAATTTTGG - Intronic
1051187374 9:14474436-14474458 AGGTTTTAACATACGAATTTTGG + Intergenic
1051260142 9:15256035-15256057 AGGTTTCAACATATGAATTTTGG - Intronic
1051312891 9:15795383-15795405 AGATTTTAACACATGAACTTTGG + Intronic
1051371140 9:16360210-16360232 AGGTTTCAACATATGAATTTAGG + Intergenic
1051519987 9:17975558-17975580 AGGTTTCATCATGTGGATTTGGG + Intergenic
1051544712 9:18260799-18260821 AGTTTTAAATATATGGGATTTGG - Intergenic
1051753068 9:20365057-20365079 AGGCTTTGACATAGGGAAATAGG - Intronic
1051811717 9:21056925-21056947 AGATTTTAAGATATGAATTTTGG - Intergenic
1051814021 9:21083118-21083140 AGGTTTTAACATGTGAAATTTGG + Intergenic
1051821269 9:21172259-21172281 GGGTTTCAACATATGAATTTTGG - Intergenic
1051877228 9:21805551-21805573 AGGTTTCAACATACAGATTTTGG - Intronic
1051885143 9:21884785-21884807 GGGTTTCAACATATGAACTTTGG + Intronic
1051921329 9:22269468-22269490 AGGTTTCAATATATGAATTTTGG - Intergenic
1051922831 9:22287763-22287785 AGGTTTTCATACAAGGAATTCGG - Intergenic
1051970727 9:22884317-22884339 AGGCTTCAATATATGAAATTTGG + Intergenic
1051976491 9:22956393-22956415 AGCGTTTAACATATGAATTTTGG + Intergenic
1052595713 9:30555319-30555341 AGAATTTAAGAAATGGAATTTGG - Intergenic
1052703654 9:31968113-31968135 AGGTGAGAACATATGGTATTTGG - Intergenic
1053038011 9:34842413-34842435 AGGTTTCAATCTATGAAATTTGG - Intergenic
1053096942 9:35336771-35336793 GGATTTTAACATATGAATTTTGG + Intronic
1053185849 9:36015789-36015811 AAGTTTCAACATATGAATTTAGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1053743567 9:41168751-41168773 CTTTTTTAACATATGAAATTGGG + Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054348840 9:63998552-63998574 CTTTTTTAACATATGAAATTGGG + Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054446570 9:65324940-65324962 CTTTTTTAACATATGAAATTGGG + Intergenic
1054483706 9:65696570-65696592 CTTTTTTAACATATGAAATTGGG - Intronic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054684776 9:68262522-68262544 CTTTTTTAACATATGAAATTGGG - Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054765684 9:69040752-69040774 AGGTTTTAACATATGAATGGTGG - Intronic
1054837787 9:69697743-69697765 AGGTTTCAACATATGAATTTTGG + Intergenic
1054902861 9:70388136-70388158 AGGCTTCAACATAGGGATTTTGG - Intronic
1054935356 9:70681851-70681873 AGGTTTCAACATATGCACTTTGG - Intronic
1054999636 9:71434218-71434240 AAGTTTAAACATATGAATTTTGG - Intronic
1055095791 9:72412774-72412796 TGTTTTTAACATATGAATTTGGG - Intergenic
1055182525 9:73405436-73405458 GGGTTTCAACATATGAATTTTGG - Intergenic
1055370536 9:75593633-75593655 ATGTTTCAACATATGAATTTGGG - Intergenic
1055483806 9:76736736-76736758 GGATTTTAACATATGAAGTTTGG + Intronic
1055618611 9:78099614-78099636 AGGCTTTAACATATGGATTTTGG - Intergenic
1055663891 9:78534181-78534203 AGGTTTCAACATATGAATTCTGG - Intergenic
1055923878 9:81489970-81489992 AGGTTTTAACACAGGAATTTTGG + Intergenic
1056217470 9:84418705-84418727 GGGTTTCAACATATGCATTTTGG - Intergenic
1056236173 9:84596976-84596998 AAGTTTCAACATATGAATTTTGG - Intergenic
1056389630 9:86129032-86129054 GGGTTTCAACATATGCATTTTGG - Intergenic
1056625437 9:88249310-88249332 GGGTTTCAACATATGAATTTGGG - Intergenic
1056775801 9:89511833-89511855 AAGTTTCAACATATGAATTTGGG - Intergenic
1056844772 9:90027728-90027750 GGGTTTCAATATATGGATTTTGG + Intergenic
1056893207 9:90515330-90515352 AGGTTTCAACATATGAATTTCGG + Intergenic
1057895035 9:98902467-98902489 AGGTTTCAACATATGAATTTTGG - Intergenic
1057968730 9:99531918-99531940 AAGTTTCAACATATGAATTTTGG - Intergenic
1057974371 9:99588737-99588759 AGGTTTCAACACATGAATTTGGG - Intergenic
1058095827 9:100859249-100859271 AGATTTCAACATATGAATTTTGG + Intergenic
1058166053 9:101620394-101620416 AGGTTTCAACATATGAATCTGGG + Intronic
1058403826 9:104648632-104648654 AACTTCTGACATATGGAATTAGG - Intergenic
1058541292 9:106015030-106015052 AAGTTTTGACATATGAACTTGGG + Intergenic
1058739482 9:107929025-107929047 AGATTTCAACATATGAATTTAGG - Intergenic
1058862434 9:109129024-109129046 GGGTTTCAACATATGAATTTGGG + Intergenic
1058996731 9:110306303-110306325 AAGGTAAAACATATGGAATTTGG - Intronic
1059116108 9:111600943-111600965 GGATTTTAACACATGAAATTGGG + Intergenic
1059726259 9:117011254-117011276 AGGTTTCAACATAGGGATTTGGG - Intronic
1059910176 9:119034528-119034550 AAGTTTCAACATATGAATTTGGG + Intergenic
1059946272 9:119411496-119411518 AGGTTCCAACATATGAATTTGGG - Intergenic
1060369931 9:123059244-123059266 AGGTTTTAACATATGAATTTTGG - Intronic
1060379043 9:123148153-123148175 AAGTTTCAACATATGAATTTTGG - Intronic
1060647446 9:125293054-125293076 TGGATTTATGATATGGAATTTGG + Intronic
1060768087 9:126309870-126309892 AGGTTTCAACATGTGAATTTGGG - Intergenic
1060854092 9:126900984-126901006 AGGTTTCAGCATATGAATTTTGG + Intergenic
1060898372 9:127234927-127234949 AAGTTTCAACATATGAATTTTGG + Intronic
1060908153 9:127326682-127326704 AGGCTTTAACATATGAATTTTGG - Intronic
1061020638 9:128012191-128012213 AGGTTGTCACATGTTGAATTTGG - Intergenic
1061435769 9:130560854-130560876 AGGTTCTAACATATGAAAACAGG + Intergenic
1061752967 9:132793337-132793359 AGATTTTAACATATGAATTTTGG + Intronic
1061784108 9:133014818-133014840 GGGTTTTAACATATGAATTTTGG - Intergenic
1203423843 Un_GL000195v1:19511-19533 AATTTGTAACATATGGCATTGGG - Intergenic
1185714121 X:2327647-2327669 GGGCTTTAACATAGGGATTTGGG - Intronic
1186208173 X:7221903-7221925 GGGTTTCAACATATGAATTTTGG - Intronic
1186385989 X:9110605-9110627 AGGTTTTTGGATATGGAAATAGG - Intronic
1186482953 X:9910081-9910103 AGGTTTCAACATAGGAATTTGGG + Intronic
1186916389 X:14226812-14226834 AGGTTTTAATATACGGAAACAGG + Intergenic
1186987025 X:15028337-15028359 AGGATTCAACATATGAATTTGGG - Intergenic
1187105524 X:16237590-16237612 AGGTCTCAACATATGAATTTTGG + Intergenic
1187186540 X:16992094-16992116 AGGTTTCAACATAGGAATTTGGG - Intronic
1187221261 X:17328283-17328305 AGATTTTAACATATAAATTTTGG + Intergenic
1187365216 X:18661119-18661141 GGGTTTCAACATATGAATTTTGG - Intronic
1187569698 X:20488478-20488500 AGGTTTCAACATATACATTTGGG - Intergenic
1187677549 X:21732766-21732788 AGGCTTCAACATATGAATTTGGG - Intronic
1188138380 X:26518069-26518091 AGGTTTCAAAATATGAATTTGGG + Intergenic
1188228440 X:27631006-27631028 AGGTTCCAACATATGAAATTTGG + Intronic
1188411061 X:29872452-29872474 AGCTTTCAACATATGAATTTTGG - Intronic
1188556540 X:31418398-31418420 AGGTTTCCACATATGAATTTTGG + Intronic
1188748037 X:33871553-33871575 AGGTTTCAGCATATGCATTTTGG + Intergenic
1188929434 X:36088357-36088379 GGGTTTCAACATATGAATTTGGG - Intronic
1189058829 X:37729795-37729817 CGATTTTACCATATGGAATAGGG + Exonic
1189074183 X:37898301-37898323 AGGTTTCAACATATGAATGTGGG + Intronic
1189256833 X:39646501-39646523 GGGTTTTAACATATGGGTTTTGG - Intergenic
1189666371 X:43359037-43359059 AGGTTGCAACATATGGATTTGGG + Intergenic
1189731647 X:44027127-44027149 AGATGTTAACATATGAATTTTGG - Intergenic
1189880632 X:45487807-45487829 AGGTTTTAACATATGAATTTTGG - Intergenic
1189890725 X:45599461-45599483 AGGTTTTAACATGTGAATATGGG + Intergenic
1190006194 X:46740786-46740808 AGGTTCTAACCAATGCAATTAGG + Intronic
1190135612 X:47794718-47794740 AGTTTCTAACATATGAACTTTGG - Intergenic
1190135730 X:47795889-47795911 AGATTTCAACATATGAATTTTGG - Intergenic
1190148403 X:47919799-47919821 GGATTTTAACATATGAATTTTGG + Exonic
1190163984 X:48056308-48056330 AGGTTTCAAAATATGAATTTTGG + Intronic
1190223819 X:48530482-48530504 GGGCTTTAACATATGAATTTGGG + Intergenic
1190973512 X:55376464-55376486 AGGTTTCAACATATAAATTTTGG + Intergenic
1191130245 X:57000092-57000114 AGGCTTTAACATATACATTTAGG + Intergenic
1191713772 X:64179765-64179787 AGGTTTCAACATATGAATTTGGG - Intergenic
1191780116 X:64855719-64855741 AGGTTTTAAAATATGAAATTCGG + Intergenic
1191790683 X:64969130-64969152 ATGTTTCAACACATGAAATTTGG + Intronic
1191801523 X:65086494-65086516 AGGTTTCAACATATGGATTTCGG - Intergenic
1191896242 X:65996294-65996316 GGGTTTCAACATATGAATTTGGG + Intergenic
1192250044 X:69404575-69404597 AGGTTTCAACATATAAATTTTGG - Intergenic
1192532982 X:71905324-71905346 AGGTTTCAACATGTGGATTTTGG - Intergenic
1192941475 X:75917448-75917470 AGGTTTTGACATGTGAATTTGGG - Intergenic
1193052701 X:77117878-77117900 AGGTTTCAACATGTGAATTTTGG - Intergenic
1193378764 X:80793875-80793897 CAGTTTTAAAATATGGAATCAGG + Intronic
1193920876 X:87424714-87424736 AGTTTTTTAAATATGGAATTAGG + Intergenic
1194001737 X:88438109-88438131 AGGTTTCAACATAAGAATTTGGG - Intergenic
1194334511 X:92629026-92629048 AGGTTTCAATATATGAATTTTGG + Intergenic
1194487540 X:94504142-94504164 AGGTTTCAACATGTGAAATTTGG + Intergenic
1194548732 X:95271154-95271176 AGGTGTTAAAATATGGGATTCGG - Intergenic
1194642665 X:96421677-96421699 AAGTTTCAACATATGAATTTTGG + Intergenic
1194731200 X:97457709-97457731 ATGTTTCAACATATGTATTTTGG - Intronic
1194818020 X:98469133-98469155 AGGTTTCAACATATGAATTTTGG + Intergenic
1194819412 X:98487743-98487765 GGGCTTTAACATATGAATTTGGG + Intergenic
1194833162 X:98650358-98650380 AGGTTTCAACATGTGAATTTTGG - Intergenic
1194942679 X:100030756-100030778 AGGATTTTACATATATAATTTGG + Intergenic
1194980139 X:100432126-100432148 AGGTTTCAACATATGATTTTTGG - Intergenic
1195116826 X:101707576-101707598 AGGTTCCAACATATGAATTTTGG + Intergenic
1195138688 X:101936362-101936384 AAGTTTCAACATATGAATTTTGG + Intergenic
1195801322 X:108715040-108715062 AACTTTTAATATATGGAATATGG + Intergenic
1195850993 X:109281117-109281139 AAGTTTCAACATATGAACTTTGG - Intergenic
1196323235 X:114368956-114368978 AGGTTTCAACATATGAATCTAGG + Intergenic
1196381673 X:115098139-115098161 AGGTTTCAACATATGAATTTTGG - Intergenic
1196404045 X:115346086-115346108 AGGTTTCAATATATGAATTTTGG - Intergenic
1196577181 X:117333013-117333035 AGATTTTAATCTATGAAATTTGG - Intergenic
1197013154 X:121591696-121591718 AGGTTTCAACACATGTATTTTGG - Intergenic
1197034911 X:121861486-121861508 AGGTTTCAACATATGAATTTTGG + Intergenic
1197442079 X:126503908-126503930 AGCTTATAACACATGAAATTTGG + Intergenic
1197521679 X:127506195-127506217 AGCCTTCAACATATGGATTTTGG + Intergenic
1197651792 X:129073227-129073249 AGATTTCAACATATGAATTTTGG - Intergenic
1197712992 X:129685517-129685539 AGGTTTCAACATATGAATTTTGG + Intergenic
1197731912 X:129818004-129818026 GGGCTTCAACATATGGAACTGGG - Intronic
1197846110 X:130804894-130804916 AGGTTTCAACCTATGAATTTTGG - Intronic
1197929748 X:131682086-131682108 ACGTTTCAACATATGAATTTTGG - Intergenic
1197931442 X:131700016-131700038 AGGTTTCAACATATAAATTTTGG - Intergenic
1197956046 X:131949772-131949794 GGGTTTCAACATATGGATTTCGG - Intergenic
1198181432 X:134213562-134213584 AGTTTTTAACAAGTGAAATTTGG - Intergenic
1198449360 X:136751532-136751554 AGGTTTCAACATATGAATTTGGG - Intronic
1198549105 X:137726063-137726085 AGGTTTCAACATATGAATTCAGG - Intergenic
1198644134 X:138787907-138787929 GGATTTCAACATATGGATTTTGG + Intronic
1198881969 X:141291523-141291545 AGGTTTCAACATATGAATTCTGG + Intergenic
1198948117 X:142038303-142038325 AGTTTTTAACACATAAAATTTGG + Intergenic
1199123093 X:144081451-144081473 GGATTTTAACATATGAATTTTGG - Intergenic
1199181888 X:144867051-144867073 AGGCTTTAACATATGAATTTTGG - Intergenic
1199210053 X:145197507-145197529 TGGTTATAACATTTTGAATTTGG - Intergenic
1199225322 X:145366187-145366209 AAGTTTCAACATATGAATTTTGG + Intergenic
1199301288 X:146217333-146217355 AGGTTTCAACATATAAATTTTGG - Intergenic
1199495818 X:148451195-148451217 AGGTTTCAACATATGAATTTGGG + Intergenic
1199557358 X:149123717-149123739 GGATTTTAACATATGAATTTTGG - Intergenic
1199561390 X:149167097-149167119 AAGTGATAACATATGGTATTTGG - Intergenic
1199713518 X:150489502-150489524 AGGTTTCAACATATGAATTTGGG + Intronic
1200129786 X:153835101-153835123 AGGTTTCAGCATATGAATTTTGG + Intergenic
1200354585 X:155534840-155534862 GAGCTTTAACATATGGACTTAGG - Intronic
1200393188 X:155964975-155964997 AGGTTTCAACATATGAATTTTGG + Intergenic
1200642989 Y:5746080-5746102 AGGTTTCAATATATGAATTTTGG + Intergenic
1200643215 Y:5748126-5748148 AGGTTTCAACATATAAATTTTGG + Intergenic
1201255192 Y:12100440-12100462 AAGTTTTAACATATACATTTTGG + Intergenic
1201712500 Y:17008020-17008042 AGGTTTTCACAAATGAATTTTGG - Intergenic
1201910142 Y:19125496-19125518 AGGTTTAAACAAATGAATTTTGG - Intergenic