ID: 1109980276

View in Genome Browser
Species Human (GRCh38)
Location 13:69897911-69897933
Sequence CAGTTAAACCTCAGGAACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109980272_1109980276 -5 Left 1109980272 13:69897893-69897915 CCCTGTGGTTACTGAGTCCAGTT 0: 1
1: 0
2: 1
3: 11
4: 142
Right 1109980276 13:69897911-69897933 CAGTTAAACCTCAGGAACTCAGG 0: 1
1: 0
2: 2
3: 12
4: 150
1109980273_1109980276 -6 Left 1109980273 13:69897894-69897916 CCTGTGGTTACTGAGTCCAGTTA 0: 1
1: 0
2: 1
3: 5
4: 95
Right 1109980276 13:69897911-69897933 CAGTTAAACCTCAGGAACTCAGG 0: 1
1: 0
2: 2
3: 12
4: 150
1109980271_1109980276 0 Left 1109980271 13:69897888-69897910 CCATTCCCTGTGGTTACTGAGTC 0: 1
1: 0
2: 0
3: 20
4: 210
Right 1109980276 13:69897911-69897933 CAGTTAAACCTCAGGAACTCAGG 0: 1
1: 0
2: 2
3: 12
4: 150
1109980269_1109980276 29 Left 1109980269 13:69897859-69897881 CCAGATTTAGATTTATTGATTTA 0: 1
1: 2
2: 5
3: 86
4: 784
Right 1109980276 13:69897911-69897933 CAGTTAAACCTCAGGAACTCAGG 0: 1
1: 0
2: 2
3: 12
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109980276 Original CRISPR CAGTTAAACCTCAGGAACTC AGG Intronic
905508149 1:38496458-38496480 CCATTAAAACTCAGGAACTGGGG - Intergenic
906838198 1:49106986-49107008 CAGTTGAACCTCATGATCTTAGG - Intronic
906846005 1:49192846-49192868 GAGTTTAACGTCAGGTACTCTGG - Intronic
908994390 1:70133938-70133960 AACTTAAACATCAGGAACTGTGG + Intronic
910352308 1:86312393-86312415 CAGTGAAGCTTCAGGGACTCAGG - Intergenic
910560010 1:88579851-88579873 CAGCTGAATCTCAGGAACTATGG - Intergenic
912052533 1:105548067-105548089 CAATTATACCTCAGTAAGTCTGG + Intergenic
912264021 1:108137298-108137320 CAGTTAAATCTCAGGAAGTAAGG + Intronic
914882352 1:151557053-151557075 CAGTTAATCCACAGGAAGGCAGG - Intronic
915034233 1:152909131-152909153 CAGCTAAACCTCAGAAGGTCAGG + Intronic
915040812 1:152966990-152967012 CAGCTAAAATTCAGGAACCCTGG + Intergenic
916871104 1:168915759-168915781 CAATTATCCCTCAGGAACTCAGG + Intergenic
917603540 1:176602223-176602245 CAGTGAAACCTCAGGGAATGAGG - Intronic
918201504 1:182271576-182271598 AGGTTAAACCTAAGGAAATCTGG + Intergenic
918663301 1:187116360-187116382 CAGACAAACATCAGAAACTCTGG - Intergenic
918665883 1:187150401-187150423 CAGTGAAAACATAGGAACTCAGG + Intergenic
918921593 1:190718462-190718484 CAGTTAAACCAAAGGAAGTCTGG + Intergenic
919628999 1:199941399-199941421 CAGTAAACCCTCAGTGACTCCGG + Intergenic
919749236 1:201026201-201026223 CAGCTAATCCTGAGAAACTCTGG - Intergenic
919948175 1:202337740-202337762 CAGTTATACCTCAGTAAAGCTGG - Intronic
1065111435 10:22444174-22444196 CAGTACTACCTTAGGAACTCAGG + Intronic
1067041608 10:42956022-42956044 CAGTTAAACCCCATGAAGCCTGG + Intergenic
1068068463 10:52164750-52164772 CAGTTACACCTCAGTAAAACTGG - Intronic
1073704454 10:105967308-105967330 CAATTATACCTCAAGAAATCTGG + Intergenic
1076371946 10:129960891-129960913 CAGAGAAGCCTCTGGAACTCCGG - Intronic
1078210803 11:9267771-9267793 CTGTTGATCCTCTGGAACTCAGG - Intergenic
1081665699 11:44915920-44915942 CAGTGAGACCTCAGGGGCTCAGG + Intronic
1084849865 11:71929910-71929932 CGTTTAAAACTCAGCAACTCCGG - Intronic
1086588273 11:88481508-88481530 CTGTGTAAACTCAGGAACTCTGG + Intergenic
1087461551 11:98454272-98454294 CAGGTGTACCTTAGGAACTCTGG + Intergenic
1095255700 12:40033179-40033201 CAGTTAAAATCCAGGAAGTCTGG + Intronic
1095586891 12:43859631-43859653 CAGTTATACCCCAGCAACTGTGG - Intronic
1096861147 12:54529213-54529235 CAGTCAAACTCCAGGAACTGGGG + Intronic
1098714698 12:73815263-73815285 CATTGAGAACTCAGGAACTCAGG - Intergenic
1100878073 12:98984174-98984196 CAGTTAAACCAGAGGACCTCTGG - Intronic
1108999494 13:56779789-56779811 CAGGTATACCTCAGCAGCTCAGG - Intergenic
1109980276 13:69897911-69897933 CAGTTAAACCTCAGGAACTCAGG + Intronic
1111585769 13:90282467-90282489 AATTTAAACCTAAGTAACTCTGG + Intergenic
1112218284 13:97459464-97459486 AAGCTAGACCTCAGGAATTCGGG - Intronic
1112432844 13:99367431-99367453 CAGTTAACTCTTAGGAGCTCAGG - Intronic
1113444470 13:110355171-110355193 CAGTTACACCTAAGGGACCCTGG - Intronic
1119090315 14:71774726-71774748 CAAATAAACATCTGGAACTCCGG - Intergenic
1119745653 14:77042032-77042054 CAGCTAAGCCCCAGGAACTTGGG - Intergenic
1121102730 14:91261306-91261328 CACTTAAACCACAGGTGCTCAGG - Intergenic
1121730873 14:96186185-96186207 CAGCCAAACCTCCAGAACTCGGG - Intergenic
1122642287 14:103167062-103167084 CAGCTGAACCTCAGGAATTCTGG - Intergenic
1123789619 15:23707884-23707906 CAGTTATTTCTCAGTAACTCAGG + Intergenic
1124895605 15:33773942-33773964 CACTTTAACCTCAGAAACTCTGG - Intronic
1125534107 15:40433310-40433332 TATTTAACCCTCAAGAACTCTGG - Intronic
1127622427 15:60746864-60746886 TAGTTAAACCCGAGGAACTAGGG + Intronic
1127909295 15:63402765-63402787 CAGTTAAAACTCAGTTACTAAGG - Intergenic
1130899210 15:88194378-88194400 CAGCTAAACATCTGGAGCTCAGG - Intronic
1133905643 16:10020072-10020094 CAGTTAAACCTCAATAAAGCTGG + Intronic
1134239633 16:12495953-12495975 CAGTAGAATCTCATGAACTCAGG + Intronic
1134466998 16:14487890-14487912 CAATTAAACCTCAGTTATTCTGG + Intronic
1137668920 16:50267946-50267968 CAGGTAAACCTTGGGAACCCAGG - Intronic
1139897028 16:70295770-70295792 CAGGTGAACCTCTTGAACTCAGG + Intronic
1142601433 17:1054785-1054807 CAGTTTGCCCCCAGGAACTCAGG + Intronic
1142837913 17:2602878-2602900 AAGTTGAACCTCAGGTACTGAGG + Intronic
1144796044 17:17891905-17891927 TAGTTAATTCTGAGGAACTCTGG - Intronic
1148812725 17:50304355-50304377 CAGTTATAGCTAAGCAACTCGGG - Intergenic
1149840219 17:59957028-59957050 CAGTGAAACCTGAGGACCGCTGG + Intronic
1149996237 17:61407379-61407401 CAGCCAGACCTCATGAACTCAGG + Intronic
1151662076 17:75524600-75524622 CAGTGACCCCTCTGGAACTCAGG + Exonic
1152932049 17:83114969-83114991 CAGTCAAACCTCAGGGTCTACGG + Intergenic
1156782512 18:40867791-40867813 CAGGGAAACCTCAAAAACTCAGG - Intergenic
1157734930 18:50039067-50039089 AAGTGACACCTCAGGCACTCAGG - Intronic
1158896750 18:61921415-61921437 CAGAGAAACCTCATGAATTCAGG + Intergenic
1158970882 18:62665292-62665314 CAGTTAGGCCTCTGCAACTCAGG + Intergenic
1159998333 18:74990158-74990180 CAGTGAAACTTCAGGTACTCGGG + Intronic
925553385 2:5101274-5101296 CATTTAAACTTCAGGTCCTCTGG + Intergenic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
926584693 2:14673321-14673343 CACGGGAACCTCAGGAACTCAGG - Intergenic
927233266 2:20846245-20846267 AAGTTAAACCTTAGGTAGTCAGG + Intergenic
927346583 2:22050981-22051003 CAGGTGAAACTCAGAAACTCAGG - Intergenic
927925284 2:27008586-27008608 GAGTTAAACCTGAGTTACTCTGG - Intronic
928649320 2:33388144-33388166 CATTGAAACCTCAGTAACCCCGG + Intronic
932094322 2:68833839-68833861 CAGTTAAACCTCCTAACCTCTGG + Intergenic
935853148 2:107244874-107244896 CAGTTGAAACTCAGAAAATCTGG - Intergenic
936233035 2:110720628-110720650 CAGTTGACCCTCAGGAAATGTGG + Intergenic
940107423 2:150115275-150115297 CAGTTAAAACTCCCTAACTCTGG + Intergenic
941702861 2:168623449-168623471 CAGTTATACCTCAGTAAAGCAGG + Intronic
941795105 2:169590337-169590359 CATTTAAACCTTAGAAAGTCAGG + Intronic
945058789 2:205890651-205890673 GAGTTAAACATCAGGAACTCAGG + Intergenic
947973079 2:234340786-234340808 CAGTTAACCCTGAACAACTCAGG + Intergenic
1169353357 20:4888059-4888081 CAGGTAAACCTCAGGCACCCAGG + Intronic
1173043776 20:39490403-39490425 CAGTTCAACCTCTGCATCTCTGG + Intergenic
1173216249 20:41087290-41087312 CAGTTAAAAATCAGGACATCTGG - Intronic
1174390987 20:50218119-50218141 CTGGTAAACCTCAGGCATTCAGG - Intergenic
1177530750 21:22355162-22355184 CAATAAAACCTCAGGTACTGGGG + Intergenic
1178291333 21:31371208-31371230 CAAATAAACTTCAGAAACTCTGG - Intronic
1183094108 22:35541957-35541979 CAGAAAAAGCTCAAGAACTCTGG - Intronic
952821461 3:37489981-37490003 CAGTTGAACCCCAGGAAATAGGG - Intronic
953999531 3:47544784-47544806 CAGGAGAACCGCAGGAACTCTGG + Intergenic
955058710 3:55478068-55478090 GAGTTAAGCTTCAGGAACACAGG - Intronic
955866324 3:63388269-63388291 CAGATATCCCTCAGGAATTCAGG - Intronic
959481629 3:106879822-106879844 CAGTTATACCTCAGTAAAGCTGG + Intergenic
960316511 3:116184981-116185003 CAGTTAAACCACAAGAAATCTGG - Intronic
960381889 3:116972875-116972897 CAGTTGAATCTCTGGGACTCTGG + Intronic
964649548 3:158995362-158995384 CAGTTATACCTCAGTAAATTTGG + Intronic
964701158 3:159569098-159569120 CATTTAAAACACAGGGACTCAGG - Intronic
966139985 3:176746029-176746051 AAGTTAAACCTCAAAAAGTCTGG + Intergenic
966520484 3:180869060-180869082 CAGGTGAACCTGAGGAATTCTGG + Intronic
967008054 3:185403652-185403674 CAGTTATACCTCAGTAAAGCTGG + Intronic
970292997 4:14596866-14596888 CAATTAAGCCTCACCAACTCTGG - Intergenic
971000985 4:22322210-22322232 GATTCAAACCTCAGGAAGTCTGG - Intergenic
977547858 4:98406362-98406384 CAGTGAAACCTAAGGAAGGCTGG + Intronic
979186527 4:117802350-117802372 CAGTTATACCTCAGAAAAGCTGG + Intergenic
979837817 4:125395211-125395233 CAGTTATATCTAAGGAACTGTGG + Intronic
980176885 4:129356740-129356762 CAGTAATTCCTCAGGTACTCGGG - Intergenic
980303981 4:131032354-131032376 CAGTTATACCTCAATAAATCTGG + Intergenic
985665216 5:1178618-1178640 CAGTGAAGCCTCACAAACTCAGG + Intergenic
986206888 5:5633013-5633035 CAGATAAAACTCAAGAACTATGG + Intergenic
986457450 5:7933576-7933598 CAGTGAATTCTAAGGAACTCAGG + Intergenic
986823630 5:11496931-11496953 CAGTCAAAACTCAGGAACTCAGG - Intronic
987214742 5:15722504-15722526 CACTTAGATCTCAGGAACCCTGG - Intronic
990150960 5:52816727-52816749 AGGTTATACCTCAGGAATTCTGG - Intronic
993029148 5:82684189-82684211 CAGTTAAACTTCAGAAAAACAGG + Intergenic
994340175 5:98617717-98617739 CAGTTAAACATCACAAGCTCTGG - Intergenic
994355549 5:98790551-98790573 CAATTCCAACTCAGGAACTCAGG - Intronic
995045024 5:107635918-107635940 CAGTTAAACCTAAGGGACATGGG + Intronic
995894425 5:116995785-116995807 CAGTTATACCTCAAGAAAGCTGG - Intergenic
996920858 5:128765892-128765914 CAGCAAAATCTGAGGAACTCAGG - Intronic
999863845 5:155679122-155679144 CAGGTGAACCTTAGGAATTCCGG - Intergenic
1000128247 5:158268598-158268620 CAGCTAAACCTCAGGCCTTCTGG + Intergenic
1002129589 5:177072129-177072151 CAGTTAACCCTCAGGACAACTGG + Intronic
1002168337 5:177361708-177361730 CAGTCAAAGCTCAGGAAATTGGG + Intronic
1004883936 6:20034227-20034249 CAGTCAGATCTCAGGATCTCGGG + Intergenic
1010710452 6:79168651-79168673 CAGTTTAGCCTCAGAAACTTGGG + Intergenic
1011217863 6:85024455-85024477 CAGTGAAGCTTCAGGAAGTCAGG - Intergenic
1012076631 6:94694960-94694982 CAATTATACCTCAGGAAAGCTGG - Intergenic
1013839128 6:114369305-114369327 CTGTTGGACCTCAGGATCTCAGG + Intergenic
1014072871 6:117203771-117203793 GAGTGAAAGGTCAGGAACTCTGG - Intergenic
1014276969 6:119398692-119398714 CAGGTGCACCTCAGGAATTCTGG + Intergenic
1016902495 6:149116188-149116210 TAGTGATAGCTCAGGAACTCAGG + Intergenic
1017292072 6:152749471-152749493 GAATTAAGCCACAGGAACTCTGG + Intergenic
1022213951 7:28239570-28239592 CAATTAAACCTCAATGACTCAGG + Intergenic
1022777065 7:33537885-33537907 CATTTTAACCTCATGAACACTGG + Intronic
1022979445 7:35590524-35590546 AAGTTAAACTTCAGGGACTTAGG - Intergenic
1023903892 7:44507498-44507520 CAGTTAGATATCTGGAACTCAGG + Intergenic
1028195528 7:87903173-87903195 CAGTAGAATCTCTGGAACTCGGG - Intronic
1031368622 7:120935954-120935976 CAGTTAAATCTCAGGCAGTTTGG + Intergenic
1032588810 7:133173496-133173518 AAGTGAAATCTCAAGAACTCTGG - Intergenic
1033469077 7:141627842-141627864 CAGTTAAATCTCAGATACTCTGG - Intronic
1037630505 8:20651494-20651516 CATTTAAGCCTCAGAACCTCAGG + Intergenic
1051352156 9:16207055-16207077 GAGTTAAACCTAAGGTTCTCTGG + Intronic
1052085755 9:24263673-24263695 CAGTTTTACCACAGAAACTCAGG - Intergenic
1052273343 9:26651184-26651206 CAGTAAGACCTCAGGAACCCAGG + Intergenic
1056850395 9:90079178-90079200 CAGTTAACCCTCAGGTATTGGGG - Intergenic
1057862474 9:98652424-98652446 CAGTAAACTCTCAGGGACTCAGG - Intronic
1057884991 9:98823224-98823246 CAGCGGAACTTCAGGAACTCAGG - Intronic
1058483553 9:105421037-105421059 CGGTTAAACCTATGGAACTCTGG - Intronic
1059649096 9:116298172-116298194 CAGACATGCCTCAGGAACTCAGG + Intronic
1060535079 9:124379546-124379568 TAGTTGAAACTCAGGAACTGAGG + Intronic
1187234082 X:17450404-17450426 CATTTAATCCTCACCAACTCTGG + Intronic
1187657263 X:21490858-21490880 CCTTTAAACCTAAGGAACTTTGG - Intronic
1188101297 X:26091241-26091263 CAATTAAACCTCAGTAAAACTGG - Intergenic
1189214654 X:39312512-39312534 CAGTGAAATTTCTGGAACTCTGG - Intergenic
1189391827 X:40582724-40582746 CAGTTAAACCACAGGATCAAAGG - Intronic
1192715615 X:73638731-73638753 GAGTTAAACAACAGGAACACAGG - Intronic
1194647068 X:96470969-96470991 CAGTTAAAGAGCAGGAACACTGG - Intergenic
1197878072 X:131132819-131132841 CAGTTCAACCCCAGTCACTCTGG - Intergenic
1198372870 X:136008326-136008348 CAGGTGAACCTCATGAACCCGGG - Intronic
1199537733 X:148922362-148922384 CAGTTAGACCTGAGTAAGTCTGG + Intronic
1199800916 X:151249845-151249867 AAGCTATACCTCAGGGACTCTGG - Intergenic