ID: 1109980917

View in Genome Browser
Species Human (GRCh38)
Location 13:69905393-69905415
Sequence AGTCTAAATTGACCAAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109980916_1109980917 15 Left 1109980916 13:69905355-69905377 CCATGCACTGAACTTGGGGTGTT 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1109980917 13:69905393-69905415 AGTCTAAATTGACCAAATGCTGG 0: 1
1: 0
2: 0
3: 7
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109980917 Original CRISPR AGTCTAAATTGACCAAATGC TGG Intronic
906613165 1:47217469-47217491 AATCTAAATTACCCAAATGCTGG + Exonic
908137034 1:61143765-61143787 AGTCTATATTCAGCAAGTGCAGG + Intronic
908959656 1:69680759-69680781 TCTCTAATTTGACCAGATGCAGG + Intronic
909824490 1:80110185-80110207 AGTCTAAAAACAACAAATGCTGG - Intergenic
913374364 1:118134198-118134220 AGTCTAAATTTAGCAAAAGGGGG + Intronic
916264564 1:162877676-162877698 ACTCTAAATTCAGAAAATGCTGG + Intergenic
916865497 1:168852602-168852624 AGCCAAAATTGACCATATGTTGG + Intergenic
917955108 1:180088077-180088099 AGTCTAAATTGAGAAAATGTGGG + Intronic
923863598 1:237916655-237916677 AGCCCAGATTGACCAAATGGTGG - Intergenic
1065658092 10:27973935-27973957 AGTCAAAATATAGCAAATGCTGG - Intronic
1066555969 10:36613141-36613163 AAGCTAAATTAACTAAATGCTGG - Intergenic
1072127297 10:92458261-92458283 AGTCAAAATTAAATAAATGCAGG + Intronic
1075234007 10:120710351-120710373 AGGCTAAGATGACCAAATGGTGG + Intergenic
1076804943 10:132850658-132850680 AGTATAAATGGACCAAAGACGGG - Intronic
1080076307 11:28153809-28153831 ATTCTAAATTGTCCAGATTCTGG + Intronic
1083740100 11:64705187-64705209 AGCCCAAATAAACCAAATGCAGG + Intronic
1087054737 11:93922600-93922622 AATCATAATTGACCAATTGCTGG + Intergenic
1087149603 11:94847070-94847092 AGTCTAAAGTCACTAAATTCAGG + Intronic
1089790442 11:120939341-120939363 AGCCTTTATTGAACAAATGCTGG + Intronic
1090761535 11:129841038-129841060 ACTGGAAATTGACAAAATGCAGG + Intronic
1094003113 12:25717849-25717871 AGTGATAATTGACCAAATGTAGG + Intergenic
1094245010 12:28280156-28280178 AGTTTAAATAGATCAAATACAGG - Intronic
1097090423 12:56500312-56500334 AGCCCAGATTGACCAAATGGTGG + Intergenic
1097204129 12:57305856-57305878 AGCCAAAATTGACCTAATCCTGG + Intronic
1098568590 12:71963238-71963260 AGTCTAATTTTATCAAACGCAGG + Intronic
1099908788 12:88804116-88804138 TGTCAAAATTTACCAAATGCAGG - Intergenic
1100159232 12:91838319-91838341 ACTCTAATATGACTAAATGCTGG - Intergenic
1101583206 12:106062284-106062306 TGTCCAAATTGACCAGGTGCTGG - Intergenic
1109980917 13:69905393-69905415 AGTCTAAATTGACCAAATGCTGG + Intronic
1117614170 14:57516238-57516260 AGTCTGAATAGACCAATAGCAGG - Intergenic
1118456500 14:65949564-65949586 AGTCTATATTGAGAAAATACGGG + Intergenic
1119859953 14:77929065-77929087 TGTCTAAAGTGAGCAAATGGAGG - Intronic
1122913958 14:104847737-104847759 AGACTAAATGGACAAAATACCGG - Intergenic
1126247139 15:46520605-46520627 AGTATATATGGACCCAATGCTGG + Intergenic
1129560191 15:76558512-76558534 AGTCAAAAATGAACAGATGCTGG + Intronic
1131217301 15:90549320-90549342 AGTGTAAATTGATCACATACTGG + Intronic
1131701829 15:94945114-94945136 AGTCTAAAGTGACAGAAAGCAGG - Intergenic
1132967824 16:2669132-2669154 AGCCCAGATTGACCAAATGGTGG + Intergenic
1147837912 17:43348239-43348261 AGCCCAGATTGACCAAATGGTGG + Intergenic
1150347210 17:64413516-64413538 AGGCTACAGTGACAAAATGCTGG - Intronic
1158868207 18:61658526-61658548 AGTTGTAATTCACCAAATGCAGG + Intergenic
1159107114 18:64015212-64015234 AGTTGAAGTTCACCAAATGCTGG - Intergenic
1159261564 18:66019973-66019995 ACTCTATATTGACCAAGAGCAGG - Intergenic
1159306618 18:66651747-66651769 AGTTTAAATAGACAAAAAGCTGG - Intergenic
1161639926 19:5415676-5415698 CTTCTAAAATGGCCAAATGCTGG - Intergenic
1164084520 19:21889127-21889149 AGCCCAGATTGACCAAATGGTGG + Intergenic
1165670131 19:37671093-37671115 ATTCAAAATAGACCATATGCTGG + Intronic
924975325 2:168561-168583 AGTCTGAAAACACCAAATGCTGG + Intergenic
926763168 2:16297466-16297488 AATCTAAATTACCCAAATGAGGG - Intergenic
928817610 2:35318527-35318549 ATTCTAAATTGGCCAACAGCCGG + Intergenic
930697315 2:54425126-54425148 AGTCAAAATTTTCCAAAAGCTGG - Intergenic
931469366 2:62522404-62522426 TATCAAAATTGATCAAATGCTGG - Intergenic
932549413 2:72752650-72752672 AGTCTAATTTGAGGAAATGGAGG - Intronic
936039262 2:109137255-109137277 AGTCTAGATTTGCCAAATGAAGG + Intronic
942852822 2:180510523-180510545 AGTCAAAAATTAACAAATGCTGG + Intergenic
943456423 2:188113153-188113175 AGACAAAATCGATCAAATGCAGG + Intergenic
943815218 2:192245889-192245911 TGTCTAAATAGATCAAATCCTGG + Intergenic
944039981 2:195342401-195342423 ATTATAAAATGACAAAATGCGGG + Intergenic
944194910 2:197042266-197042288 AGGCTAGATTTGCCAAATGCAGG - Intronic
1168783633 20:517727-517749 ACCCTAAAATGACCAAAGGCTGG + Intronic
1172203994 20:33149017-33149039 AGTATAAATAGAGCAAATGATGG + Intergenic
1173960729 20:47070387-47070409 AGACTGAAATGACCAAGTGCTGG + Intronic
1177201776 21:17965313-17965335 ATTCAAAATTCACCATATGCTGG + Intronic
1177297709 21:19198621-19198643 AGAGAAAATTGACCAAATGATGG - Intergenic
1177723589 21:24939075-24939097 AATGTAAACTGAGCAAATGCGGG + Intergenic
1178150333 21:29786779-29786801 AGTTAAAATGGATCAAATGCAGG - Intronic
1184844910 22:47076488-47076510 ATTTTAAAATGTCCAAATGCAGG - Intronic
952325847 3:32320055-32320077 AATCTAAATTGACCCCTTGCTGG + Intronic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
959412813 3:106046590-106046612 AATGTTAATTGACCAATTGCTGG + Intergenic
959768233 3:110059441-110059463 GGTCTAGATTTACCAAATACTGG - Intergenic
961728279 3:128947672-128947694 ATTCAAAATTGATCAAAGGCTGG + Intronic
963490170 3:145989905-145989927 AGTCAAAATATAACAAATGCTGG + Intergenic
964287490 3:155134790-155134812 AGTCAAAAATGAACAGATGCTGG - Intronic
965769261 3:172163895-172163917 AGTCTGAATGTACCAAAGGCTGG - Intronic
971928821 4:33051139-33051161 AGTCAAAATTGACCTACTGTGGG - Intergenic
972219866 4:36941744-36941766 AGTCAAAAGTGAACAAATGTTGG + Intergenic
974623796 4:64396323-64396345 AGTCAAAAATTAGCAAATGCTGG - Intronic
975812899 4:78188025-78188047 AGTTTAAATTCACCAAGTGTAGG + Intronic
977981641 4:103329897-103329919 AGTCAAAATGATCCAAATGCAGG - Intergenic
978776736 4:112512746-112512768 GGTCAAAAATGACCAAATGAAGG - Intergenic
986385862 5:7232742-7232764 AATGTAAATGGACTAAATGCTGG + Intergenic
988142179 5:27257740-27257762 ACTCTAAATTGAGCCAATGTTGG - Intergenic
990974427 5:61546206-61546228 AGTCTATAATCACCAAATTCAGG - Intergenic
991470502 5:66963850-66963872 AGTCTGAAGTAATCAAATGCTGG - Intronic
994218643 5:97168570-97168592 TGCCTTAATGGACCAAATGCAGG + Intronic
994415081 5:99459469-99459491 AGTCTAAATTAACTACATTCTGG - Intergenic
998257424 5:140599008-140599030 AGATTACATTGAACAAATGCTGG - Intergenic
1001094826 5:168768033-168768055 AGTCTCAACTCACCAAAGGCAGG - Intronic
1005256081 6:24004720-24004742 AGTCTAAATTCATCAACTGCTGG - Intergenic
1009547647 6:65041791-65041813 ATTATATATTGACCAAATACTGG - Intronic
1010803600 6:80208056-80208078 TGTCAAAATTGGCCAAATGCTGG + Intronic
1013138386 6:107305304-107305326 AGTGGAAAATGACCAAGTGCTGG - Intronic
1013446105 6:110229097-110229119 TGTCAAAATTGTCAAAATGCTGG + Intronic
1018949199 6:168367922-168367944 AGTCAAGATTAACCCAATGCTGG + Intergenic
1021188225 7:17590536-17590558 AGTCTAAATCCAACACATGCTGG + Intergenic
1021644218 7:22772070-22772092 AGCCTAACTTGACCATAGGCTGG + Intergenic
1022383626 7:29883378-29883400 AGTCAAATTTCACAAAATGCTGG + Intronic
1023122017 7:36919228-36919250 AGTCACTATTAACCAAATGCTGG - Intronic
1027614500 7:80404667-80404689 AGTGTAAATTGAAGAAAGGCTGG - Intronic
1028862026 7:95663082-95663104 AGTCTAAATTGGTCATAGGCTGG + Intergenic
1030890128 7:114989557-114989579 AGTCTAAATACACTATATGCTGG - Intronic
1032944888 7:136838198-136838220 GGTCTAAATTCACCAAAGGCTGG + Intergenic
1035423321 7:158748000-158748022 AATCTACAGTGACCAAAGGCAGG + Intronic
1035976748 8:4321110-4321132 AGTCTAAATCAATCAAAGGCAGG + Intronic
1039535037 8:38302370-38302392 ACTCTAAATAGATCAGATGCTGG - Intronic
1041428007 8:57745222-57745244 AGCCTAAATTTAGCAGATGCTGG - Intergenic
1045574168 8:103400834-103400856 AGTTTTAATTGACCTAATGTAGG + Intronic
1046140918 8:110090342-110090364 AGTCAAAAATCAACAAATGCTGG - Intergenic
1046340685 8:112850889-112850911 AATCTATTTTGACCATATGCTGG - Intronic
1046709462 8:117493545-117493567 AGTCAAAAATTAACAAATGCTGG - Intergenic
1047244786 8:123131958-123131980 AGTCTAACTTGACAAAAAGATGG - Intronic
1047926220 8:129685596-129685618 AGTCTGAATTTTCCACATGCTGG + Intergenic
1049880154 8:145056492-145056514 AGCCCAGATTGACCAAATGGTGG - Intergenic
1051536222 9:18161169-18161191 AGTATAAATAGACAAAATGTTGG + Intergenic
1052034428 9:23663819-23663841 GCTCTAAAGTGATCAAATGCTGG + Intergenic
1052899119 9:33775141-33775163 ACTGGAAATTGACAAAATGCAGG + Intronic
1056934103 9:90902775-90902797 AGCCCAGATTGACCAAATGGTGG - Intergenic
1058196890 9:101987875-101987897 AGTCAAAAATTACCAGATGCTGG - Intergenic
1059234187 9:112748432-112748454 AATCTAAACTGAGCAAATGGAGG + Intergenic
1059883922 9:118723248-118723270 AGTCAAAATTCAACAAATACTGG - Intergenic
1061114825 9:128603166-128603188 ACCCTAAATTTAACAAATGCTGG - Intronic
1061653175 9:132067594-132067616 AGTCTCCATAGACAAAATGCAGG + Intronic
1187615255 X:20986947-20986969 AGTCAAAAATTAACAAATGCTGG + Intergenic
1189068621 X:37838753-37838775 ATTCTAAATAGAAGAAATGCTGG - Intronic
1192043407 X:67646408-67646430 AGGGTAAAATGACCAAATTCTGG + Intronic
1193901348 X:87181895-87181917 ATGCTAAATTCACCAAATGCTGG - Intergenic
1194679787 X:96838175-96838197 TGACTAAATTGATCAAATTCTGG + Intronic
1194904113 X:99552189-99552211 AGTCAAAATTTAACAGATGCTGG - Intergenic
1197614928 X:128680317-128680339 AATCTGAAGTCACCAAATGCAGG + Intergenic
1198178369 X:134179245-134179267 AGTAAAAATTGACTAAATGTAGG - Intergenic