ID: 1109981152

View in Genome Browser
Species Human (GRCh38)
Location 13:69909644-69909666
Sequence CATTCCATGCATGAGTTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109981152 Original CRISPR CATTCCATGCATGAGTTCTG GGG Intronic
900471480 1:2857091-2857113 GACTCCATGCATGAGGTCGGGGG + Intergenic
901173925 1:7284897-7284919 CCTTCCTTGCACGAGTTCTGTGG - Intronic
901431348 1:9216892-9216914 CATGCCTTGCATGAGATCTAAGG - Intergenic
901440037 1:9272243-9272265 CCTCCCATACATGTGTTCTGGGG + Intergenic
902678221 1:18023856-18023878 CATTACATGAATAAGTTCTTTGG - Intergenic
905251241 1:36650005-36650027 CATTCCCCGCAGGACTTCTGTGG - Intergenic
905262082 1:36726844-36726866 CATTCCAGGCATGAGGAATGAGG - Intergenic
906730077 1:48073446-48073468 CATTCCAGGAATGAGTTTTGAGG - Intergenic
911044301 1:93615995-93616017 CATTTCATTCACGATTTCTGGGG - Intronic
911401560 1:97381432-97381454 CATGCCAAGCATGGGCTCTGTGG + Intronic
913529480 1:119723402-119723424 CATTCCACAAGTGAGTTCTGCGG - Exonic
914416819 1:147491696-147491718 CCTTCCATGCCTGACTTCAGTGG - Intergenic
915913152 1:159926498-159926520 CATTCTATGCTTGAGTTCCCTGG + Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
917565962 1:176211843-176211865 CTTTCCAGGCATTATTTCTGAGG + Intergenic
917630166 1:176883730-176883752 CATCCCATGCATAAGTTTTTGGG + Intronic
921322351 1:213954120-213954142 CATAGCATGCATGAGGTGTGCGG - Intergenic
924568552 1:245218152-245218174 GATTCCCAGCCTGAGTTCTGGGG - Intronic
924736996 1:246766936-246766958 CATTCTATGCATGTGTTTGGTGG - Intronic
1065133938 10:22650038-22650060 AATCCCATGGATGGGTTCTGGGG - Intronic
1066555313 10:36606356-36606378 CATTCCATGCATGTGGACAGTGG - Intergenic
1073551447 10:104405807-104405829 CATTCCATTCAAGAATTCTAGGG + Intronic
1075264781 10:120990966-120990988 CATGCCATAAATGAGGTCTGGGG + Intergenic
1075907519 10:126094441-126094463 CATTCAATGGAAGAGTTTTGTGG - Intronic
1076642599 10:131929010-131929032 AACTCCAGGCGTGAGTTCTGGGG - Intronic
1077433469 11:2527171-2527193 CTTCCCTTTCATGAGTTCTGTGG + Intronic
1078011066 11:7573625-7573647 TTCTCCATGCATGTGTTCTGTGG + Intronic
1079120637 11:17682113-17682135 GATTACAGGCATGAGTTCTAAGG - Intergenic
1079305055 11:19314632-19314654 AATTCCATGCATGAGATGGGAGG - Intergenic
1084671724 11:70610844-70610866 CATTCTTGGCATGAGTCCTGTGG - Intronic
1084983405 11:72845950-72845972 CCTTCCATGTATCAGTGCTGTGG - Intronic
1085035071 11:73294905-73294927 TATGCCATGGATGAGCTCTGTGG - Intronic
1086756790 11:90574075-90574097 CATTCAATGCAATGGTTCTGTGG + Intergenic
1088077576 11:105870132-105870154 AATCCCCAGCATGAGTTCTGTGG - Intronic
1088734658 11:112718845-112718867 GATTCCATGCCTGAGCTCTGGGG - Intergenic
1089574624 11:119432576-119432598 CACTCCAGGCATGAGGTGTGGGG + Intergenic
1089710201 11:120309055-120309077 AAGTCCATGGATGAGTTATGTGG - Intronic
1092713434 12:11363059-11363081 CATTCCTTGCCTGATTTCTAGGG + Intronic
1095707847 12:45257205-45257227 CATTTCTTGCATGTTTTCTGAGG + Intronic
1099051683 12:77788711-77788733 GATTCCAGGCATGAGTACTGCGG + Intergenic
1102898068 12:116614550-116614572 AATTCCCGGCATGAGTTCTGGGG + Intergenic
1102926223 12:116828440-116828462 CATCCCATGCCTCAATTCTGGGG + Intronic
1103996672 12:124834429-124834451 CACTCCAGGCATGAGGTCTCGGG + Intronic
1106584130 13:31042797-31042819 CATTCTTTGCTTTAGTTCTGTGG + Intergenic
1106898979 13:34334971-34334993 CAGACCATGCGTGAGTCCTGGGG + Intergenic
1107405128 13:40105221-40105243 CATTTCATGACTCAGTTCTGTGG + Intergenic
1108091817 13:46857323-46857345 CATTCCAGCCTTGAGATCTGTGG - Intronic
1109981152 13:69909644-69909666 CATTCCATGCATGAGTTCTGGGG + Intronic
1110264067 13:73518598-73518620 CTTTCCATGCATGATCTCAGTGG + Intergenic
1110797372 13:79655835-79655857 CATTACATGCATGACTTTGGTGG - Intergenic
1111736181 13:92141998-92142020 CATTCCAAGCATGAGATGTGAGG - Intronic
1111736344 13:92144609-92144631 CACTCTATGTATTAGTTCTGTGG - Intronic
1113646444 13:111999869-111999891 CATGCCATGCAGGAGATGTGGGG - Intergenic
1115413741 14:33106737-33106759 CTTCCCGTGCATCAGTTCTGCGG - Intronic
1115979517 14:39034675-39034697 CATTTCAAGCAGGAGCTCTGTGG - Intronic
1120734139 14:88034622-88034644 CCTTCCCTGCCTGACTTCTGAGG + Intergenic
1127951792 15:63814956-63814978 CATTTTATACATGAGATCTGAGG - Intronic
1129546828 15:76404553-76404575 CATTGCATGTAAGAGTCCTGCGG + Exonic
1130210345 15:81916525-81916547 TATTCCATGCCTGACTACTGAGG - Intergenic
1133654762 16:7850166-7850188 TGTTCCATGCCTGGGTTCTGTGG + Intergenic
1134119306 16:11572336-11572358 CATTTCATGCATGAGGACTCGGG - Intronic
1135522383 16:23187404-23187426 CACTCCATCAATGACTTCTGAGG + Intronic
1137370842 16:47904375-47904397 CATTACATGGATGTGCTCTGGGG - Intergenic
1139273249 16:65703196-65703218 CATTCCAAACAGGAGCTCTGGGG - Intergenic
1140769684 16:78191854-78191876 CATTCCATCCATCACTCCTGAGG - Intronic
1143688496 17:8539313-8539335 CATTCCAGGGATGAGTTTTATGG - Intronic
1146001440 17:29132936-29132958 CACACCATGCAGTAGTTCTGGGG + Intronic
1150754988 17:67903767-67903789 CTTTCTATGCATGAATTCTTAGG + Exonic
1150978461 17:70115401-70115423 CTTTAAATGAATGAGTTCTGAGG - Intronic
1151268136 17:72972357-72972379 CATTTCATAGATGTGTTCTGTGG + Intronic
1157212611 18:45756810-45756832 ATTTCCATGCATTATTTCTGAGG - Intergenic
1158121615 18:54054819-54054841 CTGTCCATCCATGAGATCTGAGG + Intergenic
1159476984 18:68934474-68934496 AATTCCACTCATGATTTCTGAGG + Intronic
1162317509 19:9948671-9948693 CATTCTATGCATGAACTCTTAGG - Intergenic
1163004912 19:14391105-14391127 CTTTCCATCCATGAGGTTTGGGG + Intronic
1165214511 19:34260821-34260843 CATTCCATGCATGCCTTCCTGGG - Intronic
925062671 2:905215-905237 CTTACCATGCTTGGGTTCTGTGG + Intergenic
925877042 2:8320359-8320381 CATTTAATGAAAGAGTTCTGTGG + Intergenic
926611451 2:14952196-14952218 CTTTCCATGCAGGGATTCTGTGG - Intergenic
930317668 2:49817235-49817257 CATTCTTTGCATGACTTCTATGG + Intergenic
930595309 2:53380066-53380088 AATTCCAGGCATGGGTTCAGTGG + Intergenic
930717026 2:54602999-54603021 CATTTAATGTAGGAGTTCTGTGG - Intronic
936796087 2:116205358-116205380 TATTCCATTTATGAGTTCTTAGG + Intergenic
937425957 2:121798571-121798593 CATTGCAACCATGAGCTCTGGGG - Intergenic
943931784 2:193863956-193863978 CATTCCCTACTTGAGTTTTGAGG - Intergenic
946390059 2:219409670-219409692 CATGCCATTCATGAAATCTGGGG + Intergenic
946413682 2:219528498-219528520 GATTACATGCGTGAGTCCTGGGG + Intronic
948061640 2:235046824-235046846 CATACCATGCTTCTGTTCTGTGG + Intronic
948155802 2:235779903-235779925 CATTCCAAGCACGAGTGGTGAGG - Intronic
1169188729 20:3643232-3643254 CATGTCTTCCATGAGTTCTGGGG - Intronic
1173405679 20:42762452-42762474 TTTTCCATTCATGTGTTCTGTGG - Intronic
1175786229 20:61713319-61713341 CACTCCTTGCAGGAGGTCTGGGG - Intronic
1181494056 22:23278013-23278035 CTTTCCAGGCCTGGGTTCTGAGG + Intronic
950888958 3:16386252-16386274 TCTTCCCTGCATGACTTCTGAGG - Intronic
954234158 3:49243116-49243138 CATACAATGCATGAATTCTTTGG + Intronic
954429076 3:50459662-50459684 CATTCCTGGCTGGAGTTCTGAGG - Intronic
954643881 3:52118813-52118835 CATTAGATTCATGAGTTCTTGGG + Intronic
954852703 3:53617037-53617059 CATTCCAGGCAGGTGTGCTGGGG - Intronic
955103338 3:55873146-55873168 CATTCCATGCAGGAGAGCTGTGG - Intronic
956366920 3:68514180-68514202 AATTCAATGTATGAATTCTGGGG + Intronic
956834886 3:73088761-73088783 GATTCCCTCCATGATTTCTGGGG - Intergenic
957877167 3:86162322-86162344 GATTCTATGCATGCATTCTGAGG + Intergenic
964597239 3:158447851-158447873 CATCCCATCCTTGATTTCTGAGG + Intronic
965792013 3:172399690-172399712 AATTCCATGCAGGTGTTTTGGGG + Exonic
971070233 4:23082404-23082426 CATACCATGCATGATTTAAGTGG - Intergenic
971743868 4:30553567-30553589 CAGGCCATGGATGAGTACTGGGG - Intergenic
974468326 4:62286381-62286403 CCTTCCATTCAGGAGGTCTGAGG + Intergenic
975171393 4:71235713-71235735 CATTCCTTGGATGGATTCTGAGG + Intronic
976156197 4:82147419-82147441 CATGTCGAGCATGAGTTCTGTGG - Intergenic
976305723 4:83557634-83557656 GATTGCATGAAAGAGTTCTGAGG - Intronic
977736600 4:100424610-100424632 CTTGCCATGCAAGAGATCTGTGG + Intronic
980687709 4:136251835-136251857 CATTCAATGCCTGTTTTCTGTGG - Intergenic
982352465 4:154430638-154430660 AATTCTAAGCATGAGTTGTGTGG + Intronic
982715719 4:158805484-158805506 AATTCAGTGCAAGAGTTCTGAGG + Intronic
986553245 5:8982251-8982273 CATTCCATGCAAAAGCTCAGAGG - Intergenic
986704905 5:10446791-10446813 GATTCCTTGCCTGAGTTATGAGG + Intronic
987034135 5:14003524-14003546 TACTCCATTCATGACTTCTGAGG + Intergenic
991354544 5:65754371-65754393 CATTCCAAGCAAGAGTACTGAGG + Intronic
991392839 5:66166958-66166980 CATTCCCTTCCTGATTTCTGGGG - Intronic
992711443 5:79461616-79461638 TATTACATGAAAGAGTTCTGAGG - Intronic
993595085 5:89844271-89844293 CATTCCATGCAAGAATTAAGGGG - Intergenic
997641371 5:135450985-135451007 CATTTCATGCCCAAGTTCTGTGG + Intronic
997719547 5:136066581-136066603 TTTTCCAGACATGAGTTCTGGGG - Intergenic
998716357 5:144889281-144889303 CATTCCAGGCCTTAGCTCTGAGG + Intergenic
999140803 5:149360182-149360204 CATTCCATGCTGGGGTCCTGGGG + Intronic
1000636982 5:163655755-163655777 CATTCCAGGCATGCGTAGTGAGG - Intergenic
1000780440 5:165473749-165473771 CATTCCAAAGATAAGTTCTGAGG - Intergenic
1002944408 6:1747212-1747234 GATTCCGTGCATGCCTTCTGTGG + Intronic
1003882378 6:10490352-10490374 CATTCCATGGATGAGTTACTGGG - Intergenic
1005915461 6:30346851-30346873 CATTCCATGATTCTGTTCTGTGG + Exonic
1009211232 6:60865653-60865675 CATACCATTCAGCAGTTCTGGGG + Intergenic
1009548299 6:65051292-65051314 CATTAAATGAAGGAGTTCTGGGG - Intronic
1015081435 6:129230200-129230222 CTTTCAATACATGACTTCTGTGG - Intronic
1016931439 6:149414575-149414597 CAATCCATGGATGAGTTCAAAGG - Intergenic
1020666068 7:11045637-11045659 CAGTCCATCCCAGAGTTCTGTGG + Intronic
1021710610 7:23412512-23412534 CATTCCAGTCATGAGTGATGTGG + Intronic
1026085861 7:67262482-67262504 CATTTCACTCCTGAGTTCTGTGG + Intergenic
1026691305 7:72552392-72552414 CATTTCACTCCTGAGTTCTGTGG - Intergenic
1028074110 7:86489857-86489879 GATGCCATGCATGTGTTTTGGGG + Intergenic
1028270282 7:88779660-88779682 CATTGCATGGAAGAGTGCTGGGG + Intronic
1028804110 7:95004632-95004654 TATTCTATGCATGAGTACTCTGG - Intronic
1030399144 7:109026732-109026754 CCTTGCATCCATGAATTCTGAGG + Intergenic
1031833631 7:126656158-126656180 CATTAAATGCCAGAGTTCTGGGG + Intronic
1033544432 7:142387073-142387095 GATACCAAGCATGTGTTCTGTGG + Intergenic
1034785556 7:153923073-153923095 CATTCCATCCTTGCTTTCTGGGG - Intronic
1038996493 8:32928718-32928740 CTTTTGATGCAGGAGTTCTGAGG + Intergenic
1040639940 8:49321419-49321441 CAGTCCATTCATGTGTTCTTTGG + Intergenic
1042475107 8:69239014-69239036 CAGACCATGCATGGATTCTGGGG + Intergenic
1049346243 8:142140478-142140500 CATTCCATGCAGGCTTTCTCAGG + Intergenic
1051853436 9:21535696-21535718 CACTTCATGAAAGAGTTCTGTGG + Intergenic
1053043627 9:34895304-34895326 CATTCCTTTCATAAGTTCGGTGG + Intergenic
1053619948 9:39804699-39804721 CATTCCAAACATGAATTTTGTGG + Intergenic
1053878126 9:42564001-42564023 CATTCCAAACATGAATTTTGTGG + Intergenic
1053894534 9:42730365-42730387 CATTCCAAACATGAATTTTGTGG - Intergenic
1054233568 9:62537693-62537715 CATTCCAAACATGAATTTTGTGG - Intergenic
1054264209 9:62902745-62902767 CATTCCAAACATGAATTTTGTGG - Intergenic
1057409297 9:94802815-94802837 CATTCCCTGGATGAGAGCTGTGG + Intronic
1058592467 9:106580176-106580198 CATTCCATGCAAGGTTCCTGGGG - Intergenic
1187174352 X:16882769-16882791 CAGTCCCCGCCTGAGTTCTGCGG - Intergenic
1188842017 X:35027923-35027945 CATTCCATGCGTGAATTCTAAGG - Intergenic
1190909206 X:54756753-54756775 AATTCCATGCATGTATACTGAGG + Intronic
1191605475 X:63057717-63057739 CATAGCATGCTTGAGTCCTGGGG + Intergenic
1193445641 X:81598300-81598322 CATTCTATGAGTGGGTTCTGGGG - Intergenic
1194201492 X:90958018-90958040 CATTCCTTGCTGGAGTTCTTGGG + Intergenic
1200547333 Y:4533473-4533495 CATTCCTTGCTGGAGTTCTTGGG + Intergenic