ID: 1109991610

View in Genome Browser
Species Human (GRCh38)
Location 13:70065632-70065654
Sequence GGGTACAAAAGATTTCCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109991606_1109991610 16 Left 1109991606 13:70065593-70065615 CCATTTAACACAAAATTTTAAGG 0: 1
1: 0
2: 3
3: 50
4: 449
Right 1109991610 13:70065632-70065654 GGGTACAAAAGATTTCCCTTTGG 0: 1
1: 0
2: 0
3: 11
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109991610 Original CRISPR GGGTACAAAAGATTTCCCTT TGG Intronic
906574704 1:46877440-46877462 GTTTACATAACATTTCCCTTTGG - Intergenic
906597268 1:47090464-47090486 GTTTACATAACATTTCCCTTTGG + Intronic
907294472 1:53440780-53440802 AGGTTCAGAAGATTTCCCTGAGG + Intergenic
912501233 1:110123474-110123496 GGGGACAACAGATTTCACTCTGG + Intergenic
916265079 1:162882447-162882469 GGGTGCAGGAGATGTCCCTTTGG + Intergenic
917935965 1:179867384-179867406 GGGCATAATAGATTTCCCTGAGG + Intronic
918555555 1:185795373-185795395 GGGAAAAAAAGGTTTCTCTTGGG - Intronic
918792813 1:188852299-188852321 AGTTAAAAAACATTTCCCTTTGG + Intergenic
918985595 1:191621451-191621473 GGGAACAAATGAGCTCCCTTAGG - Intergenic
920188229 1:204175626-204175648 GGGGAAAAAAGAGCTCCCTTGGG - Intergenic
920798004 1:209159253-209159275 GAGGCCAAAAGTTTTCCCTTGGG + Intergenic
920918602 1:210279098-210279120 GGAAACAAAGGATTTTCCTTAGG + Intergenic
923263263 1:232287699-232287721 GGGTTTAAAAAATTACCCTTCGG - Intergenic
924163431 1:241257579-241257601 GGAAACAATACATTTCCCTTTGG + Intronic
924322351 1:242862727-242862749 GTGGACAAAAAATCTCCCTTTGG - Intergenic
1064458253 10:15508567-15508589 GGGCACTGAATATTTCCCTTTGG - Intergenic
1066014021 10:31220107-31220129 GAGGACAAAAGATTAACCTTAGG + Intergenic
1066071634 10:31820742-31820764 GGGTAAAAAAAATTTCAGTTTGG - Intronic
1067669320 10:48305254-48305276 GGCCAGAAAAGATTTCCCTGAGG - Intergenic
1081223554 11:40492948-40492970 AGGTAGAAAAGATGGCCCTTGGG - Intronic
1086223496 11:84479282-84479304 TGGTACAAACTATTTCTCTTAGG + Intronic
1088363195 11:109012426-109012448 GGATCCAAGAGATTTCTCTTTGG - Intergenic
1092167736 12:6353391-6353413 GGGTACACAACACTTCCCTGGGG - Intronic
1092445187 12:8549246-8549268 GGCTCCCAAAGAATTCCCTTAGG - Intergenic
1093497311 12:19773071-19773093 GCTTACAATAGAATTCCCTTAGG - Intergenic
1097477648 12:60078568-60078590 GGGTACAAAATACATCACTTGGG - Intergenic
1099154300 12:79155793-79155815 GGCAACAGAAGAATTCCCTTTGG - Intronic
1100167715 12:91937095-91937117 GCCTACCAAAGATCTCCCTTAGG - Intergenic
1100557948 12:95716303-95716325 GGGTACATGGGATTTTCCTTAGG + Intronic
1101821606 12:108188500-108188522 GGGTGCAAAAGCCTTCCCTAGGG + Intronic
1101949248 12:109161921-109161943 GTCTACAAATGATGTCCCTTGGG + Intronic
1102050391 12:109857668-109857690 GAGCACACAAGATTTCCCCTTGG + Intronic
1102551765 12:113696499-113696521 GGCTCCAAAAGACTTGCCTTTGG - Intergenic
1102980039 12:117234224-117234246 GGGTACTAGAGATTTTCCTGAGG + Intronic
1103012900 12:117471086-117471108 GGTTACAAATGCTTTCCCATAGG - Intronic
1104650528 12:130528749-130528771 TGGTAGAAAAGAGTTCCCTTTGG - Intronic
1104811083 12:131620872-131620894 GGGGACAACAGATGTCCCTAGGG - Intergenic
1109991610 13:70065632-70065654 GGGTACAAAAGATTTCCCTTTGG + Intronic
1114375554 14:22142624-22142646 GGGTAGAACAGATTTCCCTACGG + Intergenic
1116652631 14:47613180-47613202 GGGTATAAATAATTTCCCTGTGG + Intronic
1120154588 14:81079116-81079138 GGATACAAATCATTTCCCCTGGG + Intronic
1122334956 14:100967462-100967484 GGGTACCATTTATTTCCCTTAGG - Intergenic
1123452783 15:20382462-20382484 TGGTAAAAAGTATTTCCCTTTGG + Intergenic
1124094699 15:26638220-26638242 GAGGACAAAAGAGTGCCCTTTGG - Intronic
1126458475 15:48890242-48890264 GGGTACAGTAGCTTTCCCTGTGG - Intronic
1127337963 15:58008974-58008996 GGGTGGAGAAGATTGCCCTTGGG - Intronic
1129067861 15:72922961-72922983 AGGTCCAAATGATTTCACTTGGG - Intergenic
1129700754 15:77767316-77767338 GGGGAAAAAAGATCTCCATTCGG + Intronic
1130517674 15:84638705-84638727 GGATAAAAAAGACTACCCTTGGG - Intergenic
1135672674 16:24388615-24388637 GGGAACAAGAGGTTCCCCTTAGG - Intergenic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1137384207 16:48026469-48026491 GGGTGCAAAGGATCTCCCTTGGG + Intergenic
1140117320 16:72053832-72053854 GTGTACAAAAGAATTACTTTTGG - Intronic
1141336059 16:83156467-83156489 AGGTACAAAGCATTTCCTTTAGG + Intronic
1145224401 17:21116068-21116090 GGGTACATGAGATTTCCCTAAGG - Intergenic
1146200081 17:30849596-30849618 AGGGGCAAAAGATTTCCCTAAGG - Intronic
1150162885 17:62914332-62914354 GGGAAGCAAAGATTTGCCTTGGG - Intergenic
1154395762 18:13987212-13987234 GGGAACAAAAGATGTTCCCTTGG + Intergenic
1157937825 18:51892728-51892750 GGGTTCAAAGGATTTGGCTTTGG - Intergenic
1158873047 18:61707443-61707465 GTGTGCAGAAGATTTTCCTTTGG - Intergenic
1163974722 19:20840159-20840181 GGATACTCAAGATTTCTCTTGGG - Intronic
925125309 2:1450547-1450569 TGGTACAATAGATTTCCACTGGG + Intronic
926156087 2:10454710-10454732 GGGCACAGAATGTTTCCCTTTGG + Intergenic
927057494 2:19379623-19379645 GGGTACCCAAGACTTCCATTTGG + Intergenic
927125042 2:20006213-20006235 GGAGACAAAAGTTTTCACTTTGG + Exonic
927936546 2:27079530-27079552 GGGGACAAAAGTTCTCCCTGAGG - Intronic
928277149 2:29913180-29913202 GGGCAGAGAAGATCTCCCTTGGG - Intronic
928646711 2:33361450-33361472 AGGCACAAAACCTTTCCCTTTGG - Exonic
928684331 2:33732668-33732690 TGGTTCTAAAGCTTTCCCTTAGG - Intergenic
931013173 2:57942679-57942701 TGATACAAAATATTTCCTTTTGG + Intronic
934690978 2:96359044-96359066 GGGAAGAAATGATTTCCCTTGGG + Exonic
937333963 2:121049396-121049418 GGGGACAAAAGATTCACATTAGG - Intergenic
938573189 2:132581460-132581482 GGGAACAAAAATGTTCCCTTTGG + Intronic
938707547 2:133945452-133945474 TGGTGCAAATGATTTGCCTTTGG - Intergenic
940012327 2:149067891-149067913 GGGTAGAAAAGCTTTTGCTTTGG + Intronic
943466514 2:188235628-188235650 GCGTGCAAATGATTTTCCTTTGG - Intergenic
944988932 2:205212089-205212111 GGGCACCTAAGATTTCCCTCTGG - Intronic
947349719 2:229230768-229230790 GTGTATAAAATATGTCCCTTTGG - Intronic
948149865 2:235736592-235736614 GTGGAAAAAAGATCTCCCTTTGG + Intronic
1169202127 20:3716496-3716518 GGGTCTCAAAGATCTCCCTTGGG - Intergenic
1182384402 22:29924021-29924043 GTGCACAAAAGATTTTCATTTGG + Intronic
949262420 3:2117640-2117662 GCATACAAAAGATTTTCCTTTGG + Intronic
949275458 3:2274668-2274690 GGTTTCAAAAGATATCCCTGGGG + Intronic
949770768 3:7574904-7574926 TGGAACAAAAGATTTCATTTGGG - Intronic
951528720 3:23678994-23679016 GGGAACAAAAGATTTTGGTTTGG - Intergenic
952032078 3:29155340-29155362 GGGTACAAAAGAAATTGCTTAGG - Intergenic
954915309 3:54144228-54144250 GGCTACAAAACATTTCCCCCTGG + Intronic
960409191 3:117301317-117301339 GGGTTCAAAAGATCTTCCTATGG - Intergenic
963612033 3:147481886-147481908 AAGTAGAAAAGATTTCCCTTGGG + Intronic
963737833 3:149040610-149040632 GGGTACAACAGATGTTGCTTTGG - Intronic
964781493 3:160343612-160343634 AGGTACAAATGAATTACCTTTGG - Intronic
966301956 3:178489156-178489178 TAATACAAAAGATTTCCCATGGG - Intronic
970545648 4:17127605-17127627 GTGTTCAAAAGATTCCCTTTGGG - Intergenic
971675197 4:29617586-29617608 GGGTACAAAAGATTTATCAGAGG + Intergenic
974601291 4:64084216-64084238 GGGTTCAAAAGATTTCCTGAAGG + Intergenic
976781109 4:88759988-88760010 GGGTACACAAGATTTTCTTTAGG + Intronic
977992584 4:103462483-103462505 GGGCACAGAAGACTTCCCGTGGG + Intergenic
979221186 4:118227530-118227552 AGGTGCAAAAGATTTCTCCTGGG - Intronic
981482380 4:145252349-145252371 GGGAGTAACAGATTTCCCTTTGG - Intergenic
983221427 4:165047648-165047670 GGGCTCAAGAGATTTCCCTGTGG - Intergenic
983827605 4:172283280-172283302 GGGTAATAAAGATTTTGCTTTGG + Intronic
985258982 4:188097546-188097568 GGATAGAAAACCTTTCCCTTGGG - Intronic
985264679 4:188146788-188146810 GGAAAGAAGAGATTTCCCTTGGG - Intronic
986037292 5:3952415-3952437 GGGTCCAGAAGATATACCTTTGG - Intergenic
989123473 5:38027915-38027937 GAACACAAAAGCTTTCCCTTGGG - Intergenic
992287182 5:75247823-75247845 GGGTTAAAAAGATTAGCCTTGGG + Intergenic
993094861 5:83470698-83470720 TGTTACAAAAGATTTCCAATAGG - Intergenic
996124996 5:119715026-119715048 GGGTACACAAGGTTTACCATGGG - Intergenic
999625292 5:153514071-153514093 GGGTTCAGAAGATTTTCATTTGG - Intronic
1005159479 6:22842574-22842596 GGGTACAACAGATTTCTTTTGGG + Intergenic
1005241889 6:23839846-23839868 TAGGCCAAAAGATTTCCCTTTGG + Intergenic
1008116345 6:47554982-47555004 GGGTACTAAAGATTTACCTAAGG - Intronic
1010713144 6:79198590-79198612 AGGTACAAATGCTATCCCTTAGG - Intergenic
1011203564 6:84865717-84865739 GGATGCAAAAGACTTCCCATTGG + Intergenic
1020406818 7:7844966-7844988 ACGTAAAAAAGATTTACCTTGGG - Intronic
1022840099 7:34156022-34156044 GGGAAGAAAAGATATCTCTTTGG + Intergenic
1025928258 7:65975971-65975993 GGGGGCAAAAGACCTCCCTTAGG + Intronic
1027759531 7:82260423-82260445 GGGAACTAAAGATTTCCTTGAGG + Intronic
1030798610 7:113820672-113820694 GGGAAGAAAAGCTTTTCCTTGGG - Intergenic
1031226881 7:119050529-119050551 CTGTACAATAGATTTTCCTTGGG + Intergenic
1032668417 7:134061509-134061531 GGGTACCTAAGAATTACCTTGGG - Intronic
1041028843 8:53715408-53715430 TGGTTCAAAAGATTTGCTTTTGG - Intergenic
1041572689 8:59355280-59355302 GGCTACAAAAGATTTTTCTAAGG - Intergenic
1042318299 8:67448369-67448391 GGTTAAGAAAGTTTTCCCTTGGG + Intronic
1042735209 8:71979804-71979826 GAATAAAAAAGATTTCCATTAGG - Intronic
1046968788 8:120196675-120196697 GAATACAAAAGAGTTCCCGTAGG - Intronic
1046984444 8:120371435-120371457 TGGTAGCAATGATTTCCCTTTGG + Exonic
1051225248 9:14892282-14892304 GTGTGCAAATGATTTTCCTTTGG - Intronic
1051744231 9:20279744-20279766 GGGTAGAAAAATTTTTCCTTGGG + Intergenic
1055545204 9:77364090-77364112 GGGTAAAAAAGCTCTGCCTTGGG - Intronic
1057790607 9:98122359-98122381 GTGTACATTAGAATTCCCTTGGG - Exonic
1059636817 9:116179556-116179578 CGGGTCAAAAGATTTGCCTTAGG - Intronic
1062253502 9:135609741-135609763 GTGCACATAAGATTTCCCTTTGG + Intergenic
1186243446 X:7594185-7594207 GGTTATAAAGGGTTTCCCTTTGG + Intergenic
1186303563 X:8228037-8228059 GGGTCCATAAGAGTTCCCCTTGG + Intergenic
1187925193 X:24243369-24243391 GCGTCCAAAAGTTTTCCCCTGGG - Intergenic
1190812801 X:53900906-53900928 TGGTATATATGATTTCCCTTTGG - Intergenic
1194801332 X:98277129-98277151 GGGTATAAGAGATTTCTCTAGGG - Intergenic
1196182536 X:112708118-112708140 GGGTACAAAAGCTATCCAATGGG - Intergenic
1197997023 X:132388431-132388453 TTGTTAAAAAGATTTCCCTTTGG + Intronic
1199145563 X:144362099-144362121 GGGTACAAAAGCCTTCCCCATGG + Intergenic