ID: 1109992694

View in Genome Browser
Species Human (GRCh38)
Location 13:70080195-70080217
Sequence GAGTGCTATCTGATTGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109992694 Original CRISPR GAGTGCTATCTGATTGGACC AGG Intronic
902955715 1:19923110-19923132 CAGTGCCATCTGATGAGACCTGG - Intronic
903918535 1:26782540-26782562 GAGTGCTAACAGATTGGATGTGG - Intergenic
907074204 1:51564128-51564150 GAGTGCTGTCAGGCTGGACCTGG + Intergenic
907462022 1:54610759-54610781 GAGTGGAACCTGATGGGACCAGG + Intronic
921503382 1:215934980-215935002 AAGTGCTATCTGAGTTGACCTGG + Intronic
922441961 1:225663493-225663515 AAGGTCTCTCTGATTGGACCAGG + Intergenic
922627381 1:227062380-227062402 GAGAGATTTCTGATTGAACCAGG - Intronic
923664838 1:235990861-235990883 GAGTGCTGGCTGATTATACCTGG - Intronic
1074562052 10:114543642-114543664 GAGTGTCATGTGATTAGACCAGG - Intronic
1079009669 11:16817567-16817589 GAGTGCAATGTGATTAAACCTGG + Intronic
1085713130 11:78848232-78848254 GAGGTCTATCTGATGAGACCCGG - Intronic
1088228848 11:107652437-107652459 GAATGCCATCTGTTTGGGCCAGG + Intronic
1091384800 12:86457-86479 GAGGGCTTACTCATTGGACCAGG + Intronic
1097808525 12:63992108-63992130 GAGTTTGATATGATTGGACCAGG + Intronic
1101984625 12:109436054-109436076 GAGTGTTCTCTGATCAGACCTGG + Intronic
1104608595 12:130208434-130208456 CAGTGCTATCTGCTGGTACCAGG - Intergenic
1107069477 13:36255049-36255071 GAGTGCTCTCTCAGTGGACATGG + Intronic
1109992694 13:70080195-70080217 GAGTGCTATCTGATTGGACCAGG + Intronic
1112398326 13:99053774-99053796 GTGTGCTATCTGATGGGCCCAGG - Intronic
1119826522 14:77661312-77661334 AAGTGCTAGGTGACTGGACCAGG - Intergenic
1122678184 14:103434892-103434914 GAGGGGTATCGGAGTGGACCAGG - Intronic
1126329920 15:47521197-47521219 CAGTGCTCTCTGATGGCACCTGG + Intronic
1135068601 16:19332755-19332777 GAGAACCATTTGATTGGACCAGG - Intergenic
1135521093 16:23178966-23178988 CAGTGTTAGCTGATTGGACCAGG + Intergenic
1138442456 16:57043216-57043238 GAGTGCTTTCTGGCTGGAGCTGG - Intronic
1139014841 16:62677571-62677593 GAGTGCTAATTGATTGGCTCAGG - Intergenic
1146476538 17:33167204-33167226 CAGTGCTATTTGATGGGACCAGG - Intronic
1148460929 17:47838628-47838650 GAGTGGTATCTGTATGGACTCGG - Exonic
1153517553 18:5918367-5918389 CAGTGCTGTCTGAGTGGATCTGG - Intergenic
1153708388 18:7771236-7771258 GAGTGCTATCTGTTTCCACTGGG + Intronic
1160073911 18:75653709-75653731 GGGTGTTTTCTGACTGGACCAGG + Intergenic
1162482953 19:10939797-10939819 GAGTTCTGACTGATTGGTCCAGG - Intergenic
1163221983 19:15928376-15928398 GTGGGCTTTCTGATTGGAACTGG + Intronic
1165162511 19:33826019-33826041 GAGTGCTGTCTGTTTTCACCAGG + Intergenic
926326122 2:11786105-11786127 GAGTGTTATCTCATGGGGCCAGG + Intronic
928910378 2:36415043-36415065 GACTGCTATGTGGCTGGACCAGG + Intronic
930805944 2:55490688-55490710 GAGAGGAATCTGATTGGATCAGG - Intergenic
932103700 2:68924053-68924075 GAGTGCTCTCTGAATGTACAAGG - Intergenic
932230313 2:70078329-70078351 GAGTGCTGTCTGCTTGTGCCAGG - Intergenic
935101735 2:100002122-100002144 GTTTGCTATCTGATTGCTCCTGG - Intronic
936789392 2:116133159-116133181 AAGTGCTATCTGATAAGACTGGG - Intergenic
946446827 2:219747172-219747194 GAGTCCTATCTCATGGCACCTGG + Intergenic
1170077229 20:12432887-12432909 GCGTGTTATCTGCTTGCACCAGG + Intergenic
1170635152 20:18098022-18098044 CAGTGCTCTGTCATTGGACCAGG + Intergenic
1173747993 20:45452727-45452749 GAGTGCTATCAGCTGGAACCTGG - Intergenic
954223472 3:49168251-49168273 GAGTGCAGTCTGACTTGACCTGG + Intergenic
958593391 3:96189879-96189901 GAGTGCATGCTGATTGGTCCAGG - Intergenic
962825904 3:139100915-139100937 CAGTCCCAGCTGATTGGACCAGG - Intronic
963160726 3:142149047-142149069 GAGTCCCATCTGTTTAGACCTGG - Intronic
967552953 3:190820890-190820912 AAGTGCTCTCTGATTAGGCCAGG + Intergenic
967989912 3:195123108-195123130 GAGTTCTAGCTGATTAGATCTGG - Intronic
971453756 4:26824012-26824034 CAGGGCTATTTGATTGGATCAGG + Intergenic
980999948 4:139819153-139819175 AAGTGGTATTTGATTGGGCCTGG + Intronic
981892177 4:149751672-149751694 GAGTACTTACTGAGTGGACCAGG - Intergenic
981971907 4:150673795-150673817 AAGTGATACATGATTGGACCCGG - Intronic
986124939 5:4876006-4876028 GAGTGCTATCTCCTGGGAGCTGG - Intergenic
1003252794 6:4446347-4446369 GAGTCCAATCTGATTTGACAGGG + Intergenic
1004441494 6:15659473-15659495 CAGAGCTATCACATTGGACCTGG - Intronic
1013158835 6:107521993-107522015 GAGTGCTGTCGGATCTGACCAGG + Intronic
1014618123 6:123629889-123629911 AATTACTATCTGTTTGGACCAGG + Intronic
1020781306 7:12519464-12519486 GAGAGCTGTCTGACTGGAGCTGG - Intergenic
1031345992 7:120667505-120667527 GAGTGGCATCTGACTGGATCAGG + Intronic
1039160474 8:34612761-34612783 GAGTGATTTCTCATTGGATCTGG + Intergenic
1044458533 8:92417027-92417049 GATTGCTATCTGATTAGTCAGGG - Intergenic
1047368518 8:124235185-124235207 CAGTTGTATCTGATTAGACCTGG + Intergenic
1050381003 9:5030003-5030025 GAGTGCTAACTAATTGGTTCAGG - Intronic
1052245580 9:26330053-26330075 GAGTGCTGTGTGAATGGACTGGG - Intergenic
1053602347 9:39623720-39623742 GAGTGCATGCTGATTGGGCCGGG - Intergenic
1053860000 9:42377446-42377468 GAGTGCATGCTGATTGGGCCGGG - Intergenic
1054251188 9:62718715-62718737 GAGTGCATGCTGATTGGGCCGGG + Intergenic
1054565299 9:66753228-66753250 GAGTGCATGCTGATTGGGCCGGG + Intergenic
1056285437 9:85083027-85083049 AAGTTCTTTCTGATTGGTCCTGG - Intergenic
1190747149 X:53331118-53331140 GAGAGAGATCTGATTGGTCCTGG + Intergenic
1192334449 X:70205597-70205619 GAATCCTGTCTGCTTGGACCAGG - Intergenic
1195491799 X:105479167-105479189 GAGTTCTGTCTGATTTCACCAGG - Intronic
1198777990 X:140201420-140201442 AAGTGCTCTGTGTTTGGACCTGG + Intergenic
1199448861 X:147957385-147957407 GTGTGCTATCTGACTGGGGCAGG - Intergenic