ID: 1109993517

View in Genome Browser
Species Human (GRCh38)
Location 13:70090391-70090413
Sequence CTACAACAGTACAAAGGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 97}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109993517 Original CRISPR CTACAACAGTACAAAGGTGT AGG Intronic
902924563 1:19687702-19687724 CTACAACATTAAAAAGGTATAGG - Intronic
905255208 1:36677118-36677140 CTCCAACAGTACAGAAGAGTAGG - Intergenic
910091963 1:83475134-83475156 TTACAACAGGACCAAGGTCTAGG - Intergenic
919710245 1:200720052-200720074 ATACAACATTACAAAGCCGTGGG + Intergenic
921923919 1:220696119-220696141 CTACAAAAGGACAGATGTGTGGG + Intronic
924518608 1:244786721-244786743 CTACAAAAATAAAAAGGTTTTGG - Intergenic
1063809290 10:9685084-9685106 CAATAACAGAACAAAGGAGTTGG + Intergenic
1064481342 10:15743743-15743765 CTACAACATCACAAAGTTTTGGG - Intergenic
1065477953 10:26161266-26161288 CTACAACAGAACAAAGGGTCTGG - Intronic
1070034245 10:72706466-72706488 TTATTACAGTACAAAAGTGTCGG + Intronic
1075442162 10:122488410-122488432 ATACAAAAATACAAAGGTGGTGG + Intronic
1075823625 10:125335060-125335082 CTACAAGAGTGCAGAGCTGTAGG - Intergenic
1079256110 11:18832312-18832334 CAACAACAGTAAAAAAGTGGGGG - Intergenic
1090705909 11:129336513-129336535 CAACTACAGCACAAAGGTGATGG - Intergenic
1093883220 12:24429351-24429373 CAACAACAAAAAAAAGGTGTTGG + Intergenic
1097223834 12:57465363-57465385 CTAGAAAAGTAAAGAGGTGTGGG + Intronic
1097442500 12:59628056-59628078 CAACAACAGTGGAAAGATGTTGG - Intronic
1102101738 12:110283499-110283521 CTACAGCAGAAAAAGGGTGTTGG + Intronic
1109993517 13:70090391-70090413 CTACAACAGTACAAAGGTGTAGG + Intronic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1117404170 14:55385643-55385665 CTAGGACAGTACACAAGTGTGGG + Intronic
1118849111 14:69571350-69571372 CAACAACAGTACAGACGTTTGGG - Exonic
1120522710 14:85543483-85543505 CAAAAACAGTACAATGGTTTAGG - Intronic
1121308389 14:92921835-92921857 CTAGAACAGTACACAGTTGAGGG - Intergenic
1130430253 15:83840643-83840665 CAACAACAGTACAAAGATAGAGG + Intronic
1131451883 15:92548130-92548152 CTCCAACAGTACATAGCTCTAGG + Intergenic
1131603336 15:93872729-93872751 CTACAACAGTACTAGGTTTTAGG - Intergenic
1138754910 16:59471996-59472018 CTACAACAACTCAAATGTGTTGG - Intergenic
1139097143 16:63718155-63718177 CTACACAAGTAGAAAGGTGAGGG - Intergenic
1143883848 17:10051614-10051636 CTACAACCATACAAAGCTGCTGG + Intronic
1144037436 17:11380212-11380234 CTATAACAGCACACAGGTGTTGG - Intronic
1144124130 17:12185009-12185031 CAATAACAGTACAAAGGAGATGG + Intergenic
1146981107 17:37162634-37162656 CTACAAGAGTACAAGGTGGTGGG + Intronic
1150628728 17:66861158-66861180 CAATAACAGCACAAAGGAGTTGG + Intronic
1150758611 17:67939202-67939224 CAACAACAACAAAAAGGTGTGGG + Intronic
1154973439 18:21433546-21433568 ACACAACATTACAAAGTTGTGGG - Intronic
1155455581 18:26008640-26008662 ATAATACAGTAGAAAGGTGTAGG - Intergenic
1161744881 19:6050081-6050103 CAACTACACCACAAAGGTGTGGG + Intronic
1162579775 19:11521986-11522008 CTACAAGAGTACAAGGTGGTGGG + Intronic
1166488230 19:43232988-43233010 CTACAACAGCACCAAGGAGAAGG + Intronic
930112584 2:47691206-47691228 CTACGAGAGTACAAAGTAGTGGG - Intergenic
930720626 2:54634248-54634270 CTGCAACTGCACAAAGCTGTTGG + Intronic
930746867 2:54893511-54893533 CTGTAACAGTACTAAGATGTGGG - Intronic
935041687 2:99436176-99436198 TTATAAAAATACAAAGGTGTTGG + Intronic
936384126 2:112013396-112013418 CAACAATTGTACTAAGGTGTTGG - Intronic
937281952 2:120723530-120723552 CAGCACCAGTTCAAAGGTGTGGG + Intergenic
937535310 2:122879206-122879228 CTACAACAGAGCAAAAGTGCAGG + Intergenic
944352653 2:198746760-198746782 ATTCAACTGTACACAGGTGTAGG + Intergenic
947023041 2:225704890-225704912 CTAGAGCAGTACACAGGTGCTGG + Intergenic
1169873448 20:10271490-10271512 TTAGAGCAGGACAAAGGTGTGGG + Intronic
1173007803 20:39154097-39154119 GTACAAATGAACAAAGGTGTAGG + Intergenic
1177158790 21:17525470-17525492 CAACAACTGAACAAAGGTGGGGG - Intronic
1177645080 21:23890937-23890959 CCAGAACAGTAGAAAGATGTAGG - Intergenic
1177709580 21:24755183-24755205 GAACAACAGTACAAAGGTCAGGG - Intergenic
950073351 3:10170011-10170033 CCACAACACTACAAAGTTGGTGG + Intronic
953116288 3:39995163-39995185 CAACAACGGAACAAAGCTGTAGG + Intronic
956162949 3:66373893-66373915 CCCCAACAGCTCAAAGGTGTTGG + Intronic
959882861 3:111466007-111466029 ATATAACAGTACAAATATGTTGG + Intronic
960539772 3:118849937-118849959 CTCCAGCAGTTCACAGGTGTAGG - Intergenic
976306625 4:83566201-83566223 CTACAAAAATACAAAAATGTGGG - Intronic
979230363 4:118342094-118342116 CCACAGCTGTACAAAGTTGTAGG + Intronic
979636693 4:122963261-122963283 CTAATACAGTAGAAAGGTCTTGG + Intronic
989993000 5:50790600-50790622 TTACAAAAGTACACAGGTCTAGG + Intronic
990455824 5:55986832-55986854 CTAAAATAGCACAAAGGTCTGGG - Intronic
994889523 5:105613147-105613169 CTTCAACAGTACTCAGGTCTGGG + Intergenic
996643074 5:125780947-125780969 CTACTGCAGTACAAAGATGGAGG - Intergenic
997059343 5:130482102-130482124 CTACAACACTACAAAGTGCTAGG + Intergenic
998520940 5:142799856-142799878 CTCTAACAGTACAAAGAGGTGGG - Intronic
999906396 5:156145158-156145180 CAATAACAGTACCAAGGTGATGG - Intronic
1000237881 5:159379678-159379700 CAACAACAGAACAATGGTGGAGG + Intergenic
1002438076 5:179245460-179245482 CAAGAACAGTACAAAGATGGGGG + Intronic
1006343001 6:33457097-33457119 CTACAACATTAAAAAAGTGTCGG - Exonic
1008075534 6:47141468-47141490 CTACAAAAATACAAATGTGGTGG + Intergenic
1010866012 6:80977626-80977648 CTATAACAGTAAAGAGCTGTTGG + Intergenic
1011264461 6:85500454-85500476 CTAGAACAGTACCAAGGGGATGG - Intergenic
1011589775 6:88961153-88961175 CCACCACAGGACAAAGATGTAGG - Intronic
1013959661 6:115883890-115883912 CTTCAAAAGCACAAACGTGTTGG + Intergenic
1014029068 6:116680819-116680841 CTACAACAGTGCAAAAAAGTTGG - Intergenic
1016604908 6:145909176-145909198 CTACAAAAGAACAAAGCTGGAGG - Intronic
1027308822 7:76931618-76931640 TTACAACAGGACCAAGGTCTAGG - Intergenic
1034067232 7:148148781-148148803 CAACTACAAAACAAAGGTGTGGG + Intronic
1040761076 8:50844608-50844630 CTACAAAGGTTCTAAGGTGTAGG - Intergenic
1041530389 8:58858990-58859012 ATACAACAGAATAAATGTGTGGG + Intronic
1041727390 8:61030833-61030855 GCAGAACAGTAGAAAGGTGTAGG + Intergenic
1046150814 8:110222244-110222266 CTATAACTGTAGCAAGGTGTAGG + Intergenic
1046309971 8:112422614-112422636 TTACAACAATCCAAAGGAGTGGG - Intronic
1047361270 8:124171770-124171792 CTACACCATTACTAAGGTGCAGG + Intergenic
1050183758 9:2949301-2949323 CTACAACAGTACAAAATGGAAGG - Intergenic
1050570006 9:6927998-6928020 TTCCAACAGTGTAAAGGTGTGGG - Intronic
1055854521 9:80669912-80669934 CTACTGCAGGACCAAGGTGTGGG - Intergenic
1055854765 9:80672222-80672244 CTACAGCAGTACTATGATGTGGG + Intergenic
1057296391 9:93845923-93845945 CAATAACAGCACAAAGGAGTGGG - Intergenic
1057629741 9:96709752-96709774 CTACAACAATACTGAGGTCTTGG - Intergenic
1057987859 9:99735404-99735426 CAACACCAGTTAAAAGGTGTTGG - Intergenic
1058259556 9:102812116-102812138 CTAGAAGAAAACAAAGGTGTTGG + Intergenic
1062077552 9:134599050-134599072 CTAAAACAGCAAAAACGTGTGGG + Intergenic
1186506377 X:10096335-10096357 ATAGAACAGAACAAAGGTGATGG - Intronic
1188801555 X:34537573-34537595 TTACAACATTGCAAAGGTTTTGG + Intergenic
1189938430 X:46094598-46094620 CTACACCAGTTGAAAGGTATTGG + Intergenic
1192525770 X:71842941-71842963 CAGCAACAGAACAAAGGTGGAGG - Intergenic
1193247663 X:79248805-79248827 CTAGAACATGACAAAGATGTGGG + Intergenic