ID: 1109993846

View in Genome Browser
Species Human (GRCh38)
Location 13:70095816-70095838
Sequence TGGGGGGGGTGGAGGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 12037
Summary {0: 1, 1: 2, 2: 29, 3: 863, 4: 11142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109993846_1109993859 9 Left 1109993846 13:70095816-70095838 CCCTTCTCCCTCCACCCCCCCCA 0: 1
1: 2
2: 29
3: 863
4: 11142
Right 1109993859 13:70095848-70095870 CTAATACTCTTTCCAGATGCTGG 0: 1
1: 0
2: 0
3: 14
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109993846 Original CRISPR TGGGGGGGGTGGAGGGAGAA GGG (reversed) Intronic
Too many off-targets to display for this crispr