ID: 1109993846 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:70095816-70095838 |
| Sequence | TGGGGGGGGTGGAGGGAGAA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 12037 | |||
| Summary | {0: 1, 1: 2, 2: 29, 3: 863, 4: 11142} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1109993846_1109993859 | 9 | Left | 1109993846 | 13:70095816-70095838 | CCCTTCTCCCTCCACCCCCCCCA | 0: 1 1: 2 2: 29 3: 863 4: 11142 |
||
| Right | 1109993859 | 13:70095848-70095870 | CTAATACTCTTTCCAGATGCTGG | 0: 1 1: 0 2: 0 3: 14 4: 131 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1109993846 | Original CRISPR | TGGGGGGGGTGGAGGGAGAA GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||