ID: 1109994359

View in Genome Browser
Species Human (GRCh38)
Location 13:70103930-70103952
Sequence CTGTAAAGACAGTTTATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109994359 Original CRISPR CTGTAAAGACAGTTTATGGA TGG Intronic
900368696 1:2321993-2322015 TTTTAAAAACAGTTTATGGAGGG - Intronic
901114871 1:6835308-6835330 CTGTGCAGACAGTTTATTGGTGG + Intronic
902789739 1:18759465-18759487 GTGGACAGACAGTTTATGGAGGG - Intergenic
903054191 1:20623849-20623871 CTGTAAACACAGTTTTTGATGGG + Intergenic
904470432 1:30732428-30732450 CTGGAAATACAGTGTAGGGAGGG - Intergenic
905386759 1:37609937-37609959 CTTGAAAGACAGATTAGGGAGGG - Intergenic
908970755 1:69826757-69826779 TTGGAAAGACATTTAATGGATGG + Intronic
910716016 1:90231528-90231550 CTGTAAAAACTGGGTATGGAAGG - Intergenic
912176140 1:107159787-107159809 GTGTAAACAGAGTGTATGGAAGG + Intronic
917124314 1:171672603-171672625 GTGTACAGACACTTTATGAAAGG - Intergenic
920760568 1:208780138-208780160 CTGGAAAGACAGGTTTGGGAAGG - Intergenic
1063595670 10:7433278-7433300 CTGTAAAAACATTTTATAGGAGG - Intergenic
1066017061 10:31258084-31258106 CTGTAATGATAGTTTATGATTGG + Intergenic
1066418081 10:35239354-35239376 GTGGCAAGACAGATTATGGATGG + Intergenic
1071481159 10:86066078-86066100 CTGAAAAGACAGATTAAAGAGGG + Intronic
1071683426 10:87730375-87730397 CTGGTAAGACAGGTTATGGGAGG + Intronic
1072714471 10:97740914-97740936 CAGTAAAGACATTTTATAGAAGG + Intronic
1074404881 10:113172267-113172289 CTAGAAAGACATTTTATGTAAGG + Intergenic
1074559869 10:114525940-114525962 CTGTAAAGACTTTTTTTGGGGGG - Intronic
1075117162 10:119636634-119636656 CTGTGAAGACGTTTTCTGGATGG - Intergenic
1077619642 11:3709244-3709266 CTGTAAAGAATGTTTTTGGCTGG + Intronic
1080317241 11:30964125-30964147 CTGCAAAGATAGTTTTTGTAGGG + Intronic
1080688566 11:34536174-34536196 CAGGAAAGACAGTTTTTGTAGGG - Intergenic
1082312438 11:50668796-50668818 CTGTGAAGACATATTAAGGAGGG - Intergenic
1082776599 11:57249735-57249757 CTGTAAAGACAACATATGAAAGG + Intergenic
1085849289 11:80100718-80100740 CAGAAGAGCCAGTTTATGGAAGG - Intergenic
1086128878 11:83380120-83380142 TTGAAAAGGCAGTTTATGAATGG + Intergenic
1086507862 11:87524711-87524733 GTGGAAAAACAGGTTATGGAAGG - Intergenic
1089235134 11:117017854-117017876 TTGTAAAAACACTTTATGAATGG + Intronic
1089469799 11:118711530-118711552 CTGAAAATACAGGTAATGGAAGG + Intergenic
1094193566 12:27721733-27721755 CTGTAAAGACAGTTAACAAATGG + Intronic
1095156893 12:38868168-38868190 CTGTAAAATCAATTTATTGATGG - Intronic
1097782549 12:63724799-63724821 CCGTAAAAACTGTTTCTGGAAGG + Intergenic
1099149443 12:79090770-79090792 CTGTGGTGACAGGTTATGGAAGG + Intronic
1100012867 12:89974582-89974604 CTGTAAAAACAGTCTCAGGAAGG - Intergenic
1100572554 12:95857065-95857087 CTGTAAAGATAGTGTATTTAAGG - Intergenic
1105599518 13:21874113-21874135 CCTGAGAGACAGTTTATGGAAGG + Intergenic
1106234601 13:27851363-27851385 CTGTGACGACAGTTCAGGGAGGG - Intergenic
1108964386 13:56277849-56277871 ATGGAAAGACAATATATGGAGGG + Intergenic
1109521689 13:63520758-63520780 CTAAAAAGACTGTTGATGGATGG + Intergenic
1109994359 13:70103930-70103952 CTGTAAAGACAGTTTATGGATGG + Intronic
1110019420 13:70451247-70451269 CAGGAAAGACAGTTTGTGCAGGG - Intergenic
1111263683 13:85778145-85778167 CTGTAAAAACAGTTGAGTGAGGG + Intergenic
1112174002 13:97003601-97003623 GTGTAAAGACAGTGTAGAGATGG + Intergenic
1116174791 14:41454623-41454645 TAGTAAATACAATTTATGGAAGG + Intergenic
1116854912 14:49943705-49943727 TTGTAAAGACAGTTTGATGACGG + Intergenic
1119785840 14:77313606-77313628 ATGTCAGGACAGTTTAAGGAGGG - Intronic
1120555100 14:85920159-85920181 CTTGAAAGTCAGTTTATGGCCGG + Intergenic
1120991311 14:90379919-90379941 CTGAAAAGGCAGATTATGGAGGG + Intergenic
1121880520 14:97496692-97496714 CAGAAAAGACAGTTTATTGGTGG + Intergenic
1123472147 15:20563106-20563128 CAGTAATGACAGTTACTGGATGG - Intergenic
1123645855 15:22437247-22437269 CAGTAATGACAGTTACTGGATGG + Intergenic
1123732452 15:23158097-23158119 CAGTAATGACAGTTACTGGATGG - Intergenic
1123750587 15:23355479-23355501 CAGTAATGACAGTTACTGGATGG - Intronic
1124282956 15:28379395-28379417 CAGTAATGACAGTTACTGGATGG - Intronic
1124299743 15:28532218-28532240 CAGTAATGACAGTTACTGGATGG + Intronic
1124356318 15:28997510-28997532 CAGTAAGGACAGCTTATGAAGGG + Intronic
1125545631 15:40502167-40502189 CTGGAAAGACAGTTCCTGGATGG + Intergenic
1126187649 15:45846366-45846388 TTGAAAAGATAGTTTATGGCCGG + Intergenic
1126411056 15:48373555-48373577 CTGTAAAGACTGATCATGGTTGG + Intergenic
1127513212 15:59664675-59664697 CTTTTAAGAAAGTTTATGGCTGG - Intronic
1129945480 15:79535874-79535896 TTGTGAAGACCGTTTCTGGATGG - Intergenic
1130143769 15:81255809-81255831 CTGTAAAGCCAATTGATGGCAGG - Intronic
1130161821 15:81409194-81409216 CTGTAGAGCCTGTTTATGTAAGG - Intergenic
1131505600 15:93015562-93015584 GTGAAGAGACAGTTTATGTAAGG + Intronic
1133516785 16:6517182-6517204 CTGACAAGCCACTTTATGGAAGG + Intronic
1133586070 16:7196721-7196743 CTGCAAAGTGAGTTTTTGGAAGG + Intronic
1135561586 16:23480704-23480726 CTGTACAAACAGGTGATGGAGGG - Exonic
1137241546 16:46659074-46659096 CTGTGAGGACACTCTATGGAAGG + Exonic
1137570945 16:49566022-49566044 TTGCAAAGACAGGTTAAGGATGG - Intronic
1137687866 16:50399417-50399439 CTGTAATGACAGATGGTGGAGGG + Intergenic
1138015521 16:53425012-53425034 AAATCAAGACAGTTTATGGAGGG + Intergenic
1138410581 16:56836578-56836600 CTGACAAGACAAATTATGGAGGG - Intronic
1138857848 16:60716194-60716216 CTGTAAACACAGATTTTGAAAGG - Intergenic
1139535624 16:67571232-67571254 CTGCAAAGTCAGTTTGAGGAGGG - Exonic
1140783930 16:78321964-78321986 CTGCAGAGACAGGTTGTGGATGG + Intronic
1143295631 17:5869806-5869828 CTCCAAAGAAAGTTTCTGGAAGG - Intronic
1144068585 17:11646360-11646382 CAGTAAAGGCAGTTAATGGTGGG - Intronic
1145202621 17:20960326-20960348 CTAGAAAGACATTTTAAGGAAGG - Intergenic
1148626635 17:49074351-49074373 AATTCAAGACAGTTTATGGAGGG + Intergenic
1149451496 17:56753430-56753452 CTGCACCGACAGGTTATGGAAGG - Intergenic
1149623231 17:58061552-58061574 CTGTGAAGACAGTTTCTACAGGG - Intergenic
1153082700 18:1247180-1247202 CTGGACAAACAGTTAATGGAGGG + Intergenic
1153619018 18:6959086-6959108 ATGTAAAGACAATTTATGCTGGG + Intronic
1155782281 18:29851440-29851462 GTGATAAGACAGTTTATGGGAGG - Intergenic
1156319091 18:36001362-36001384 GTGGAAAGACTGATTATGGAGGG - Intronic
1157112478 18:44834003-44834025 CTGAAAAGAAGGTTTGTGGAAGG + Intronic
1166225215 19:41390877-41390899 CTGGACAGACATTTTATGGATGG - Intronic
925538391 2:4940462-4940484 CTGCACAGAGAGTTTGTGGAAGG - Intergenic
927141462 2:20133906-20133928 CTGTAAAGACTGTTTACAGTGGG + Intergenic
928282993 2:29965043-29965065 CTGTAAAGACTGTTCATGCCTGG - Intergenic
929184334 2:39078110-39078132 ATGTACAGACATTTCATGGAAGG + Intronic
929356662 2:41033078-41033100 CTGAAAAGACAGCTTTAGGAGGG - Intergenic
929626970 2:43419183-43419205 CAGTAAATACACTTAATGGAAGG + Intronic
929830414 2:45342604-45342626 CCTTAAAGACAGGTTCTGGAAGG + Intergenic
930507940 2:52307340-52307362 ATGAAAAGACAAGTTATGGATGG - Intergenic
933024932 2:77244532-77244554 CTGAAAATAGAGATTATGGAAGG + Intronic
940127460 2:150343009-150343031 CTGAAAACAAAGTTTATGTATGG - Intergenic
941038154 2:160590358-160590380 CTTTAAAGACACTTTAAGGGAGG - Intergenic
941514576 2:166456728-166456750 CTGTTAAGACAGTTCATTGCTGG - Intronic
946576916 2:221085750-221085772 CTGTCCAGAGAGTTTAGGGAAGG + Intergenic
1170466251 20:16625086-16625108 TTGGAAAAACAGATTATGGAAGG - Intergenic
1174796002 20:53523009-53523031 CTGTAAAGAAAGTTTTCGGCTGG + Intergenic
1175705517 20:61173710-61173732 GTGTGGAGACAGTTGATGGATGG - Intergenic
1177557735 21:22714242-22714264 TTGTAAACACATTTTATGCATGG + Intergenic
1178039769 21:28627583-28627605 AGGTATAGAAAGTTTATGGATGG - Intergenic
1181371901 22:22425501-22425523 CTGGAAAGTCAGTTCATGGCTGG + Intergenic
1183252682 22:36741527-36741549 CTGGAAAGAGAGTGTGTGGAGGG + Intergenic
1184614391 22:45628161-45628183 CAGTAATTACAGTTTATGGCAGG + Intergenic
1185405771 22:50649022-50649044 ATGTAAAAACAATTTATGGCCGG + Intergenic
1185420871 22:50733687-50733709 CTGTAAATGCAGCTGATGGATGG + Intergenic
949671897 3:6407269-6407291 CTGTAAAAGGAGTTTATGGGAGG + Intergenic
951691319 3:25399401-25399423 ATGTAAAGACAGTCACTGGATGG + Intronic
952932780 3:38373051-38373073 CAGAAAAGACAGGTTAGGGATGG - Intronic
953071811 3:39527921-39527943 CTGTAAAGCCGGTTTCAGGATGG + Intronic
954522389 3:51240843-51240865 CTTTGAAGACAGCTTATGAATGG + Intronic
954691331 3:52397146-52397168 ATGAAAAGACAGCTGATGGAGGG - Intronic
955290652 3:57689589-57689611 CTTAAAAGACATTTTATGCAAGG + Intronic
955528431 3:59845993-59846015 CTGTGAAGACAGTATATAGTTGG + Intronic
956930568 3:74038536-74038558 CTTTAGAGACAGTGTCTGGAGGG + Intergenic
958701543 3:97597638-97597660 CTGTAAAGACATTTTAATGTTGG - Intronic
959206434 3:103312879-103312901 CAGTATAGAAAGTTTATAGAGGG + Intergenic
959246553 3:103877579-103877601 CTATAAAGACATTTTCTGAAGGG - Intergenic
960421007 3:117445150-117445172 CTGTAAAAATAGATTAAGGATGG - Intergenic
960598792 3:119434156-119434178 TTGTACAGACAATTTCTGGAAGG + Intronic
961239603 3:125399054-125399076 TTGGAAACACAGTTTATGGAGGG - Intergenic
965290839 3:166877537-166877559 TTTTAAAGACAGTTTTTGAAAGG - Intergenic
967050585 3:185780214-185780236 CTGGAAAGACAGATAATGAAAGG + Intronic
969544478 4:7816085-7816107 CTCTGAAGACAGTTTCTGTAAGG + Exonic
971780771 4:31031521-31031543 CTGGAAGGATAGTTTATGAATGG + Intronic
972210941 4:36836617-36836639 ATGTACAGACAGGTGATGGATGG - Intergenic
975431943 4:74303763-74303785 CTGTTAAGTCAGTTTATGGAGGG - Intergenic
977504573 4:97885713-97885735 TTGTAAACATAGTTTCTGGAAGG + Intronic
978317514 4:107455749-107455771 CAGAAAAGACACTTTATGTAAGG + Intergenic
978878018 4:113665554-113665576 CAGTAAAGACAGATTATAAAAGG + Intronic
980589157 4:134861368-134861390 TTATAAAGACACTTTATGCATGG - Intergenic
981243550 4:142507797-142507819 CAGCAAAGAAAGTCTATGGAGGG - Intronic
981418598 4:144522468-144522490 CTGTAAACCCAGTAAATGGAAGG - Intergenic
983112992 4:163776125-163776147 ATTTAAAGACAGTGTATGCAAGG - Intronic
984117405 4:175698884-175698906 CTCTAAAGGCAGTGTATGTAGGG - Intronic
984578049 4:181474438-181474460 ATGTAAAGAAAGTTTCTGGCTGG + Intergenic
984589140 4:181597310-181597332 TTGCAAACACAGTTTAGGGAAGG - Intergenic
987746144 5:21974618-21974640 CTGTAAATAGAGATTCTGGAAGG - Intronic
988174810 5:27708461-27708483 CTGGAAAGACATTTTGGGGAGGG + Intergenic
988477735 5:31602295-31602317 CTGTAATGACAGCTAATGAAAGG - Intergenic
991766350 5:69984728-69984750 CTGTAAATAGAGATTCTGGAAGG - Intergenic
991780968 5:70133425-70133447 CTGTAAATAGAGATTCTGGAAGG + Intergenic
991845583 5:70859811-70859833 CTGTAAATAGAGATTCTGGAAGG - Intergenic
991873414 5:71133739-71133761 CTGTAAATAGAGATTCTGGAAGG + Intergenic
992421394 5:76609196-76609218 CTGTTAAGACCATTTTTGGATGG + Intronic
992795407 5:80251413-80251435 CTTTATAGCCAGTTTATGCAAGG - Intronic
993081524 5:83307323-83307345 CTGTCAGAACTGTTTATGGAAGG - Intronic
993158574 5:84258842-84258864 CTGTAATGTCAGTTTATCCAAGG + Intronic
993296116 5:86143422-86143444 ATGTAAATACAGTGTATGTAAGG - Intergenic
995915772 5:117242882-117242904 CTAAAAAGAGAGTTTATTGAAGG - Intergenic
996431373 5:123382025-123382047 CGTTAAAGACAGTCTCTGGAAGG - Intronic
996640833 5:125751272-125751294 CTGTGAAGACAATTTTTTGAAGG - Intergenic
998400533 5:141846509-141846531 CTGTAATGGCAGATTCTGGAGGG + Intergenic
1001118364 5:168958296-168958318 CTGGAAGGATAGTTTATGAATGG + Intronic
1002035599 5:176466998-176467020 TTGGGAAGTCAGTTTATGGAAGG + Intronic
1003680393 6:8247541-8247563 CTGTAGAGAAAGTTTTTGAAGGG + Intergenic
1004328830 6:14702694-14702716 CTGGAATGACACTTTATGGGAGG - Intergenic
1004515730 6:16320964-16320986 TTCTAAAAAGAGTTTATGGAAGG - Intronic
1004569020 6:16827122-16827144 CTATACACACAGTTTATGTAAGG - Intergenic
1006416240 6:33905773-33905795 CTTTTCAGACAGTTTAGGGATGG + Intergenic
1008136659 6:47785052-47785074 CAGTAAAGAAAATTTAAGGAAGG + Intronic
1010014385 6:71087176-71087198 TTGCAAAGAAAATTTATGGAAGG - Intergenic
1010251026 6:73707252-73707274 CCATAAATAAAGTTTATGGATGG - Intronic
1010934066 6:81839345-81839367 CTGAACAGAAAGTTTATGAAGGG + Intergenic
1011077342 6:83450951-83450973 TTGAAGAGACAGTTTATGGAAGG + Intergenic
1011868325 6:91860463-91860485 CTATAAATACAGTTAATGAATGG - Intergenic
1015642647 6:135352357-135352379 GTGTACACACAGTTTATAGATGG - Intronic
1015765799 6:136715010-136715032 CTGAAAAGTTACTTTATGGATGG - Intronic
1015831679 6:137376869-137376891 CTTTAAAGACTGTTTATAAAAGG - Intergenic
1016654683 6:146504903-146504925 CATTAAAGACATTTTCTGGATGG + Intergenic
1016726087 6:147369514-147369536 ATGAAAAGACAATTTATAGATGG + Intronic
1017788538 6:157775552-157775574 CTGTAAAGTCAGTCAATGGTAGG - Intronic
1018136439 6:160782437-160782459 CAAAAAAGACAATTTATGGAAGG - Intergenic
1019944991 7:4320575-4320597 CTGTAGAGACAGAAAATGGAAGG - Intergenic
1020683953 7:11270551-11270573 GTGGCAAGACAGTTTATGGGAGG - Intergenic
1021234024 7:18120457-18120479 CTGTAAAGCCAATTGAGGGATGG + Intronic
1021737673 7:23655327-23655349 CTGTAAAGACAGTGAAGGAAGGG + Intergenic
1021772180 7:24015787-24015809 CTGGAAAGGCAATCTATGGATGG + Intergenic
1023160340 7:37291533-37291555 ATGTATAGGCAGTTTATAGAAGG + Intronic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1026582336 7:71628982-71629004 CTGTTCAGACTGTTTTTGGATGG + Intronic
1026692122 7:72558874-72558896 TTGCAAAGACAGTTTTAGGAGGG - Intronic
1028484127 7:91339818-91339840 CTTCAAAGACAGCTAATGGATGG - Intergenic
1031079965 7:117248870-117248892 ATGTAAACACAGTGTGTGGAAGG - Intergenic
1032397600 7:131601858-131601880 CTGGCAAAACAGGTTATGGACGG + Intergenic
1033786827 7:144742037-144742059 GTGTTAAGACAGTCTTTGGATGG - Intronic
1034339601 7:150343232-150343254 GTGGCAAGACAGGTTATGGAAGG - Intergenic
1038273544 8:26098194-26098216 GAGTAAAGACAGTTTATTGCAGG - Intergenic
1039367872 8:36950748-36950770 CTGCAAAGACATTTTCTTGAAGG - Intergenic
1039973640 8:42341344-42341366 AGGCAAACACAGTTTATGGAGGG - Intronic
1041133862 8:54734963-54734985 CTTTAAAGACAGTTTATTTTAGG + Intergenic
1043565400 8:81542100-81542122 CTGTAAAGACAATTTGCTGATGG + Intergenic
1047741186 8:127808362-127808384 CTTTCAAAACAGTTTAGGGAAGG + Intergenic
1051010172 9:12402496-12402518 TTGTAAAGACAATCTGTGGAAGG + Intergenic
1056973006 9:91224240-91224262 CTCCAAAGACAATATATGGATGG - Intronic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1058254708 9:102746711-102746733 CTCAAAAGACAAATTATGGAAGG - Intergenic
1058348533 9:103993612-103993634 CTGTAAATTCATTTTATTGAAGG + Intergenic
1186430813 X:9502993-9503015 ATTTAAAAACATTTTATGGAGGG + Intronic
1187111990 X:16311835-16311857 GTGTCAGGACAGATTATGGAAGG - Intergenic
1187754212 X:22502357-22502379 CTGTAAAGAAACTTTCTGCATGG - Intergenic
1187824816 X:23324327-23324349 CTTTAAAGAGTGTTTATGGCCGG - Intergenic
1188548658 X:31337921-31337943 CTCTAAAGCCAGATTATGCATGG + Intronic
1189234753 X:39478358-39478380 CTGTAAACACAGTAAATGTAAGG + Intergenic
1191839074 X:65497315-65497337 CTGGAAAGATAGTTTGGGGATGG + Intronic
1194349786 X:92811774-92811796 CTGGAAAGAAAGGTTATGAAAGG - Intergenic
1194483435 X:94455961-94455983 GTGACAAGACAGTTTATGGGAGG + Intergenic
1195825097 X:108991001-108991023 TTGTAAAGGCAGTTAATGAAAGG + Intergenic
1196251992 X:113471817-113471839 ATGGCAAGACAGGTTATGGAAGG - Intergenic
1198761978 X:140041745-140041767 TTGTGAAGACAGTTTACGGCTGG - Intergenic
1200739618 Y:6839107-6839129 CTTTACAGAGAGTTAATGGAAGG - Intergenic