ID: 1109994701

View in Genome Browser
Species Human (GRCh38)
Location 13:70108063-70108085
Sequence TGAGCGCTCCGAAGCTCCGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 29}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109994693_1109994701 11 Left 1109994693 13:70108029-70108051 CCCTTAGGCTGGAGATGCGCGAG 0: 1
1: 0
2: 0
3: 4
4: 37
Right 1109994701 13:70108063-70108085 TGAGCGCTCCGAAGCTCCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 29
1109994694_1109994701 10 Left 1109994694 13:70108030-70108052 CCTTAGGCTGGAGATGCGCGAGG 0: 1
1: 0
2: 0
3: 9
4: 82
Right 1109994701 13:70108063-70108085 TGAGCGCTCCGAAGCTCCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109994701 Original CRISPR TGAGCGCTCCGAAGCTCCGG AGG Exonic
903709485 1:25312095-25312117 AGAGCTCCCCGAAGCTTCGGGGG + Intronic
903717631 1:25380323-25380345 AGAGCTCCCCGAAGCTTCGGGGG - Intronic
905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG + Intronic
1067029508 10:42870943-42870965 TGAGGACTCCGAAGCTCCCATGG + Intergenic
1078164600 11:8871196-8871218 GGAGCGCTCGGAGGCGCCGGAGG + Intronic
1081973415 11:47215335-47215357 TGGGTGCTCCGAGGCTCCCGAGG + Intronic
1095518853 12:43037987-43038009 TGAGAACTCTGAAGCTCCAGAGG - Intergenic
1104670913 12:130679537-130679559 TGAGAGCTCCCAAGGTCCTGAGG + Intronic
1109994701 13:70108063-70108085 TGAGCGCTCCGAAGCTCCGGAGG + Exonic
1113943466 13:114030328-114030350 TGAGCTCTCCGAGGTTCCTGCGG - Intronic
1123019347 14:105390363-105390385 TGAGCACTGGGAAGCTCCCGGGG - Intronic
1148551227 17:48551810-48551832 GGAGCTTTCAGAAGCTCCGGTGG + Intronic
1152739303 17:82012045-82012067 TGAGGGCTCGGAAGGGCCGGTGG - Intronic
1157857138 18:51113592-51113614 TGGGAGCTCCTAAGCTCTGGGGG - Intergenic
1162959631 19:14118134-14118156 GCAGCGCTCCGAGGCTCAGGAGG + Intergenic
1165819404 19:38665117-38665139 TGAGAGCACTGAAGCTCCTGTGG + Intronic
1168110900 19:54190897-54190919 TCAGCGGTCAGAAGCTCTGGAGG - Intronic
925444267 2:3914419-3914441 TGAGCGCTGAGCAGCCCCGGGGG - Intergenic
931520693 2:63093734-63093756 TGAGCCCTCAGAGGCTCTGGTGG + Intergenic
931696373 2:64873659-64873681 TGAGCATTCTGACGCTCCGGAGG - Intergenic
1173642911 20:44616082-44616104 TGATCGCTCAGAAGCCCCTGTGG + Intronic
1178840683 21:36135512-36135534 GGAGCGCTCCGAGGGTGCGGAGG + Intronic
1184100809 22:42340994-42341016 TGCGCGCCCCGCAGCTCCGCGGG - Intronic
986827650 5:11539403-11539425 TGAGAGCTCTGTAGCTCCAGTGG - Intronic
1008444247 6:51570073-51570095 TGGGAGCTCTGAAGCTCAGGTGG - Intergenic
1019449295 7:1088491-1088513 TGAGACCACCGGAGCTCCGGGGG - Intronic
1024285706 7:47755868-47755890 TGAGCGTTCAGGAGCTCCAGCGG + Intronic
1042563335 8:70090097-70090119 TGAGGGCTCAGAGGCTCCCGAGG + Intergenic
1053447542 9:38164580-38164602 TGAGCGCTCTGAAGGTCCTCAGG - Intergenic
1061134333 9:128724454-128724476 TGGGCGCTTCGAAGATCCAGCGG + Intergenic