ID: 1109995255 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:70115203-70115225 |
| Sequence | CTCTGAACACACATAGTAGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1109995254_1109995255 | 15 | Left | 1109995254 | 13:70115165-70115187 | CCAATGCACGAGAATTTGGTCTA | No data | ||
| Right | 1109995255 | 13:70115203-70115225 | CTCTGAACACACATAGTAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1109995255 | Original CRISPR | CTCTGAACACACATAGTAGA AGG | Intergenic | ||
| No off target data available for this crispr | |||||