ID: 1109995256

View in Genome Browser
Species Human (GRCh38)
Location 13:70115210-70115232
Sequence CACACATAGTAGAAGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109995254_1109995256 22 Left 1109995254 13:70115165-70115187 CCAATGCACGAGAATTTGGTCTA No data
Right 1109995256 13:70115210-70115232 CACACATAGTAGAAGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109995256 Original CRISPR CACACATAGTAGAAGGCAGA AGG Intergenic
No off target data available for this crispr