ID: 1109998299

View in Genome Browser
Species Human (GRCh38)
Location 13:70159415-70159437
Sequence GACACTCTTGTCTCATTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109998298_1109998299 13 Left 1109998298 13:70159379-70159401 CCTTTAGTATACTGCTTTACAGA No data
Right 1109998299 13:70159415-70159437 GACACTCTTGTCTCATTAGCAGG No data
1109998297_1109998299 29 Left 1109998297 13:70159363-70159385 CCTATACTGTTGAGGACCTTTAG No data
Right 1109998299 13:70159415-70159437 GACACTCTTGTCTCATTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109998299 Original CRISPR GACACTCTTGTCTCATTAGC AGG Intergenic
No off target data available for this crispr