ID: 1110002907

View in Genome Browser
Species Human (GRCh38)
Location 13:70228589-70228611
Sequence GCCTCCTAGAAAATAGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110002907_1110002909 30 Left 1110002907 13:70228589-70228611 CCTAGTTCTATTTTCTAGGAGGC No data
Right 1110002909 13:70228642-70228664 GCATACTCAGTGCCTAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110002907 Original CRISPR GCCTCCTAGAAAATAGAACT AGG (reversed) Intergenic
No off target data available for this crispr